COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene View larger

COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene

PTXBC001187

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001187
Product type: DNA & cDNA
Ncbi symbol: COPS5
Origin species: Human
Product name: COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene
Size: 2ug
Accessions: BC001187
Gene id: 10987
Gene description: COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
Synonyms: CSN5; MOV-34; SGN5; COP9 signalosome complex subunit 5; 38 kDa Mov34 homolog; COP9 constitutive photomorphogenic homolog subunit 5; jun activation domain-binding protein 1; signalosome subunit 5; testis secretory sperm-binding protein Li 231m; COP9 signalosome subunit 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgtccgggagcggtatggcccagaaaacctgggaactggccaacaacatgcaggaagctcagagtatcgatgaaatctacaaatacgacaagaaacagcagcaagaaatcctggcggcgaagccctggactaaggatcaccattactttaagtactgcaaaatctcagcattggctctgctgaagatggtgatgcatgccagatcgggaggcaacttggaagtgatgggtctgatgctaggaaaggtggatggtgaaaccatgatcattatggacagttttgctttgcctgtggagggcactgaaacccgagtaaatgctcaggctgctgcatatgaatacatggctgcatacatagaaaatgcaaaacaggttggccgccttgaaaatgcaatcgggtggtatcatagccaccctggctatggctgctggctttctgggattgatgttagtactcagatgctcaatcagcagttccaggaaccatttgtagcagtggtgattgatccaacaagaacaatatccgcagggaaagtgaatcttggcgcctttaggacatacccaaagggctacaaacctcctgatgaaggaccttctgagtaccagactattccacttaataaaatagaagattttggtgtacactgcaaacaatattatgccttagaagtctcatatttcaaatcctctttggatcgcaaattgcttgagctgttgtggaataaatactgggtgaatacgttgagttcttctagcttgcttactaatgcagactataccactggtcaggtctttgatttgtctgaaaagttagagcagtcagaagcccagctgggacgagggagtttcatgttgggtttagaaacgcatgaccgaaaatcagaagacaaacttgccaaagctacaagagacagctgtaaaactaccatagaagctatccatggattgatgtctcaggttattaaggataaactgtttaatcaaattaacatctcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - required for meiotic nuclear division 5 homolog B (S. cerevisiae)
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
- translocase of inner mitochondrial membrane 17 homolog B (yeast)

Buy COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene now

Add to cart