Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene
PTXBC001187
New product
Data sheet of COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001187 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COPS5 |
| Origin species: | Human |
| Product name: | COPS5-COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Gene |
| Size: | 2ug |
| Accessions: | BC001187 |
| Gene id: | 10987 |
| Gene description: | COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) |
| Synonyms: | CSN5; MOV-34; SGN5; COP9 signalosome complex subunit 5; 38 kDa Mov34 homolog; COP9 constitutive photomorphogenic homolog subunit 5; jun activation domain-binding protein 1; signalosome subunit 5; testis secretory sperm-binding protein Li 231m; COP9 signalosome subunit 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgtccgggagcggtatggcccagaaaacctgggaactggccaacaacatgcaggaagctcagagtatcgatgaaatctacaaatacgacaagaaacagcagcaagaaatcctggcggcgaagccctggactaaggatcaccattactttaagtactgcaaaatctcagcattggctctgctgaagatggtgatgcatgccagatcgggaggcaacttggaagtgatgggtctgatgctaggaaaggtggatggtgaaaccatgatcattatggacagttttgctttgcctgtggagggcactgaaacccgagtaaatgctcaggctgctgcatatgaatacatggctgcatacatagaaaatgcaaaacaggttggccgccttgaaaatgcaatcgggtggtatcatagccaccctggctatggctgctggctttctgggattgatgttagtactcagatgctcaatcagcagttccaggaaccatttgtagcagtggtgattgatccaacaagaacaatatccgcagggaaagtgaatcttggcgcctttaggacatacccaaagggctacaaacctcctgatgaaggaccttctgagtaccagactattccacttaataaaatagaagattttggtgtacactgcaaacaatattatgccttagaagtctcatatttcaaatcctctttggatcgcaaattgcttgagctgttgtggaataaatactgggtgaatacgttgagttcttctagcttgcttactaatgcagactataccactggtcaggtctttgatttgtctgaaaagttagagcagtcagaagcccagctgggacgagggagtttcatgttgggtttagaaacgcatgaccgaaaatcagaagacaaacttgccaaagctacaagagacagctgtaaaactaccatagaagctatccatggattgatgtctcaggttattaaggataaactgtttaatcaaattaacatctcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - required for meiotic nuclear division 5 homolog B (S. cerevisiae) - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G - translocase of inner mitochondrial membrane 17 homolog B (yeast) |