Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene
PTXBC010142
New product
Data sheet of TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010142 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMM17B |
| Origin species: | Human |
| Product name: | TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC010142 |
| Gene id: | 10245 |
| Gene description: | translocase of inner mitochondrial membrane 17 homolog B (yeast) |
| Synonyms: | DXS9822; JM3; TIM17B; mitochondrial import inner membrane translocase subunit Tim17-B; inner mitochondrial membrane preprotein translocase; translocase of inner mitochondrial membrane 17 homolog B (yeast) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagtacgctcgggagccctgcccatggcgaattgtggatgattgcggtggagccttcactatgggtgtcatcggtggcggagtcttccaggccatcaagggtttccgcaatgcccctgttggaattcggcaccggttgagaggtagtgccaatgctgtgaggatccgagccccccagattggaggtagcttcgcagtgtgggggggcctgttctccaccattgactgtggcctggtgcggcttcggggcaaggaggatccctggaactctatcaccagtggagcattgaccggggctgtgctggctgcccgcagtggcccactggccatggtgggctcagcaatgatggggggcatcctgttggccctcattgagggcgttggcatcctcctcactcgctacacagcccagcagttccgaaatgcgcccccattcctggaggaccccagccagctgccccctaaggatggcaccccggccccaggctaccccagctatcagcagtaccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) - intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) - required for meiotic nuclear division 5 homolog A (S. cerevisiae) - protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase |