TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene View larger

TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene

PTXBC010142

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010142
Product type: DNA & cDNA
Ncbi symbol: TIMM17B
Origin species: Human
Product name: TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene
Size: 2ug
Accessions: BC010142
Gene id: 10245
Gene description: translocase of inner mitochondrial membrane 17 homolog B (yeast)
Synonyms: DXS9822; JM3; TIM17B; mitochondrial import inner membrane translocase subunit Tim17-B; inner mitochondrial membrane preprotein translocase; translocase of inner mitochondrial membrane 17 homolog B (yeast)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggagtacgctcgggagccctgcccatggcgaattgtggatgattgcggtggagccttcactatgggtgtcatcggtggcggagtcttccaggccatcaagggtttccgcaatgcccctgttggaattcggcaccggttgagaggtagtgccaatgctgtgaggatccgagccccccagattggaggtagcttcgcagtgtgggggggcctgttctccaccattgactgtggcctggtgcggcttcggggcaaggaggatccctggaactctatcaccagtggagcattgaccggggctgtgctggctgcccgcagtggcccactggccatggtgggctcagcaatgatggggggcatcctgttggccctcattgagggcgttggcatcctcctcactcgctacacagcccagcagttccgaaatgcgcccccattcctggaggaccccagccagctgccccctaaggatggcaccccggccccaggctaccccagctatcagcagtaccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
- intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
- required for meiotic nuclear division 5 homolog A (S. cerevisiae)
- protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase

Buy TIMM17B-translocase of inner mitochondrial membrane 17 homolog B (yeast) Gene now

Add to cart