Login to display prices
Login to display prices
POMGNT1-protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase Gene View larger

POMGNT1-protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase Gene


New product

Data sheet of POMGNT1-protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POMGNT1-protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001471
Product type: DNA & cDNA
Ncbi symbol: POMGNT1
Origin species: Human
Product name: POMGNT1-protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase Gene
Size: 2ug
Accessions: BC001471
Gene id: 55624
Gene description: protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
Synonyms: GNTI.2; GnT I.2; LGMD2O; MEB; MGAT1.2; RP76; gnT-I.2; protein O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase 1; UDP-GlcNAc:alpha-D-mannoside beta-1,2-N-acetylglucosaminyltransferase I.2; protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgactggaagcccagccccctcatcaagccctttggggctcggaagaagcggagctggtaccttacctggaagtataaactgacaaaccagcgggccctgcggagattctgtcagacaggggccgtgcttttcctgctggtgactgtcattgtcaatatcaagttgatcctggacactcggcgagccatcagtgaagccaatgaagacccagagccagagcaagactatgatgaggccctaggccgcctggagcccccacggcgcagaggcagtggtccccggcgggtcctggacgtagaggtgtattcaagtcgcagcaaagtatatgtggcagtggatggcaccacggtgctggaggatgaggcccgggagcagggccggggcatccatgtcattgtcctcaaccaggccacgggccacgtgatggcaaaacgtgtgtttgacacgtactcacctcatgaggatgaggccatggtgctattcctcaacatggtagcgcccggccgagtgctcatctgcactgtcaaggatgagggctccttccacctcaaggacacagccaaggctctgctgaggagcctgggcagccaggctggccctgccctgggctggagggacacatgggccttcgtgggacgaaaaggaggtcctgtcttcggggagaaacattctaaatcacctgccctctcttcctggggggacccagtcctgctgaagacagatgtgccattgagctcagcagtagaggcagagtgccactgggcagacacagagctgaaccgtcgccgccggcgcttctgcagcaaagttgagggctatggaagtgtatgcagctgcaaggaccccacacccatcgagttcagccctgacccactcccagacaacaaggtcctcaatgtgcctgtggctgtcattgcagggaaccgacccaattacctgtacaggatgctgcgctctctgctttcagcccagggggtgtctcctcagatgataacagttttcattgacggctactatgaggaacccatggatgtggtggcactgtttggtctgaggggcatccagcatactcccatcagcatcaagaatgcccgcgtgtctcagcactacaaggccagcctcactgccactttcaacctgtttccggaggccaagtttgctgtggttctggaagaggacctggacattgctgtggattttttcagtttcctgagccaatccatccacctactggaggaggatgacagcctgtactgcatctctgcctggaatgaccaggggtatgaacacacggctgaggacccagcactactgtaccgtgtggagaccatgcctgggctgggctgggtgctcaggaggtccttgtacaaggaggagcttgagcccaagtggcctacaccggaaaagctctgggattgggacatgtggatgcggatgcctgaacaacgccggggccgagagtgcatcatccctgacgtttcccgatcctaccactttggcatcgtcggcctcaacatgaatggctactttcacgaggcctacttcaagaagcacaagttcaacacggttccaggtgtccagctcaggaatgtggacagtctgaagaaagaagcttatgaagtggaagttcacaggctgctcagtgaggctgaggttctggaccacagcaagaacccttgtgaagactctttcctgccagacacagagggccacacctacgtggcctttattcgaatggagaaagatgatgacttcaccacctggacccagcttgccaagtgcctccatatctgggacctggatgtgcgtggcaaccatcggggcctgtggagattgtttcggaagaagaaccacttcctggtggtgggggtcccggcttccccctactcagtgaagaagccaccctcagtcaccccaattttcctggagccacccccaaaggaggagggagccccaggagccccagaacagacatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
- methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
- transient receptor potential cation channel, subfamily M, member 8
- eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa