ITGB2-integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) Gene View larger

ITGB2-integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) Gene

PTXBC005861

New product

Data sheet of ITGB2-integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ITGB2-integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC005861
Product type: DNA & cDNA
Ncbi symbol: ITGB2
Origin species: Human
Product name: ITGB2-integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) Gene
Size: 2ug
Accessions: BC005861
Gene id: 3689
Gene description: integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
Synonyms: LAD; LCAMB; LFA-1; MAC-1; MF17; MFI7; integrin beta-2; cell surface adhesion glycoprotein (LFA-1/CR3/P150,959 beta subunit precursor); complement component 3 receptor 3 and 4 subunit; complement receptor C3 beta-subunit; integrin beta chain, beta 2; integrin, beta 2 (complement component 3 receptor 3 and 4 subunit); leukocyte cell adhesion molecule CD18; leukocyte-associated antigens CD18/11A, CD18/11B, CD18/11C; integrin subunit beta 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggcctgcgccccccacttctcgccctggtggggctgctctccctcgggtgcgtcctctctcaggagtgcacgaagttcaaggtcagcagctgccgggaatgcatcgagtcggggcccggctgcacctggtgccagaagctgaacttcacagggccgggggatcctgactccattcgctgcgacacccggccacagctgctcatgaggggctgtgcggctgacgacatcatggaccccacaagcctcgctgaaacccaggaagaccacaatgggggccagaagcagctgtccccacaaaaagtgacgctttacctgcgaccaggccaggcagcagcgttcaacgtgaccttccggcgggccaagggctaccccatcgacctgtactatctgatggacctctcctactccatgcttgatgacctcaggaatgtcaagaagctaggtggcgacctgctccgggccctcaacgagatcaccgagtccggccgcattggcttcgggtccttcgtggacaagaccgtgctgccgttcgtgaacacgcaccctgataagctgcgaaacccatgccccaacaaggagaaagagtgccagcccccgtttgccttcaggcacgtgctgaagctgaccaacaactccaaccagtttcagaccgaggtcgggaagcagctgatttccggaaacctggatgcacccgagggtgggctggacgccatgatgcaggtcgccgcctgcccggaggaaatcggctggcgcaacgtcacgcggctgctggtgtttgccactgatgacggcttccatttcgcgggcgacgggaagctgggcgccatcctgacccccaacgacggccgctgtcacctggaggacaacttgtacaagaggagcaacgaattcgactacccatcggtgggccagctggcgcacaagctggctgaaaacaacatccagcccatcttcgcggtgaccagtaggatggtgaagacctacgagaaactcaccgagatcatccccaagtcagccgtgggggagctgtctgaggactccagcaatgtggtccatctcattaagaatgcttacaataaactctcctccagggtattcctggatcacaacgccctccccgacaccctgaaagtcacctacgactccttctgcagcaatggagtgacgcacaggaaccagcccagaggtgactgtgatggcgtgcagatcaatgtcccgatcaccttccaggtgaaggtcacggccacagagtgcatccaggagcagtcgtttgtcatccgggcgctgggcttcacggacatagtgaccgtgcaggtccttccccagtgtgagtgccggtgccgggaccagagcagagaccgcagcctctgccatggcaagggcttcttggagtgcggcatctgcaggtgtgacactggctacattgggaaaaactgtgagtgccagacacagggccggagcagccaggagctggaaggaagctgccggaaggacaacaactccatcatctgctcagggctgggggactgtgtctgcgggcagtgcctgtgccacaccagcgacgtccccggcaagctgatatacgggcagtactgcgagtgtgacaccatcaactgtgagcgctacaacggccaggtctgcggcggcccggggagggggctctgcttctgcgggaagtgccgctgccacccgggctttgagggctcagcgtgccagtgcgagaggaccactgagggctgcctgaacccgcggcgtgttgagtgtagtggtcgtggccggtgccgctgcaacgtatgcgagtgccattcaggctaccagctgcctctgtgccaggagtgccccggctgcccctcaccctgtggcaagtacatctcctgcgccgagtgcctgaagttcgaaaagggcccctttgggaagaactgcagcgcggcgtgtccgggcctgcagctgtcgaacaaccccgtgaagggcaggacctgcaaggagagggactcagagggctgctgggtggcctacacgctggagcagcaggacgggatggaccgctacctcatctatgtggatgagagccgagagtgtgtggcaggccccaacatcgccgccatcgtcgggggcaccgtggcaggcatcgtgctgatcggcattctcctgctggtcatctggaaggctctgatccacctgagcgacctccgggagtacaggcgctttgagaaggagaagctcaagtcccagtggaacaatgataatccccttttcaagagcgccaccacgacggtcatgaaccccaagtttgctgagagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
- transient receptor potential cation channel, subfamily M, member 8
- eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d

Buy ITGB2-integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) Gene now

Add to cart