Login to display prices
Login to display prices
ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene View larger

ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene

PTXBC032245

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene

Proteogenix catalog: PTXBC032245
Ncbi symbol: ATP5H
Product name: ATP5H-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d Gene
Size: 2ug
Accessions: BC032245
Gene id: 10476
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
Synonyms: ATPQ; ATP synthase subunit d, mitochondrial; ATP synthase D chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d; ATP synthase, H+ transporting, mitochondrial F1F0, subunit d; ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d; ATPase subunit d; My032 protein; ATP synthase, H+ transporting, mitochondrial Fo complex subunit D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgggcgaaaacttgctctaaaaaccattgactgggtagcttttgcagagatcataccccagaaccaaaaggccattgctagttccctgaaatcctggaatgagaccctcacctccaggttggctgctttacctgagaatccaccagctatcgactgggcttactacaaggccaatgtggccaaggctggcttggtggatgactttgagaagaaggtgaaatcttgtgctgagtgggtgtctctctcaaaggccaggattgtagaatatgagaaagagatggagaagatgaagaacttaattccatttgatcagatgaccattgaggacttgaatgaagctttcccagaaaccaaattagacaagaaaaagtatccctattggcctcaccaaccaattgagaatttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: