Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ADAT2-adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) Gene
PTXBC037955
New product
Data sheet of ADAT2-adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ADAT2-adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC037955 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ADAT2 |
| Origin species: | Human |
| Product name: | ADAT2-adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC037955 |
| Gene id: | 134637 |
| Gene description: | adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) |
| Synonyms: | tRNA-specific adenosine-34 deaminase subunit ADAT2; DEADC1; TAD2; dJ20N2; dJ20N2.1; tRNA-specific adenosine deaminase 2; adenosine deaminase, tRNA-specific 2, TAD2 homolog; deaminase domain containing 1; deaminase domain-containing protein 1; tRNA-specific adenosine deaminase 2 homolog; adenosine deaminase, tRNA specific 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaaagaagccctcgaaaatactgaagttcctgttggctgtcttatggtctacaacaatgaagttgtagggaaggggagaaatgaagttaaccaaaccaaaaatgctactcgacatgcagaaatggtggccatcgatcaggtcctcgattggtgtcgtcaaagtggcaagagtccctctgaagtatttgaacacactgtgttgtatgtcactgtggagccgtgcattatgtgtgcagctgctctccgcctgatgaaaatcccgctggttgtatatggctgtcagaatgaacgatttggtggttgtggctctgttctaaatattgcctctgctgacctaccaaacactgggagaccatttcagtgtatccctggatatcgggctgaggaagcagtggaaatgttaaagaccttctacaaacaagaaaatccaaatgcaccaaaatcgaaagttcggaaaaaggaatgtcagaaatcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) - guanine nucleotide binding protein (G protein), alpha z polypeptide - transient receptor potential cation channel, subfamily V, member 5 - Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 |