GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide Gene View larger

GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026342
Product type: DNA & cDNA
Ncbi symbol: GNAZ
Origin species: Human
Product name: GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide Gene
Size: 2ug
Accessions: BC026342
Gene id: 2781
Gene description: guanine nucleotide binding protein (G protein), alpha z polypeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatgtcggcaaagctcagaggaaaaagaagcagcccggcggtcccggagaattgaccgccacctgcgctcagagagccagcggcaacgccgcgaaatcaagctgctcctgctgggcaccagcaactcaggcaagagcaccatcgtcaaacagatgaagatcatccacagcggcggcttcaacctggaggcctgcaaggagtacaagcccctcatcatctacaatgccatcgactcgctgacccgcatcatccgggccctggccgccctcaggatcgacttccacaaccccgaccgcgcctacgacgctgtgcagctctttgcgctgacgggccccgctgagagcaagggcgagatcacacccgagctgctgggtgtcatgcgacggctctgggccgaccaaggggcacaggcctgcttcagccgctccagcgagtaccacctggaggacaacgcggcctactacctgaacgacctggagcgcatcgccgcagctgactatatccccactgtcgaggacatcctgcgctcccgggacatgaccacgggcattgtggagaacaagttcaccttcaaggagctcaccttcaagatggtggacgtgggggggcagaggtcagagcgcaaaaagtggatccactgcttcgagggcgtcacagccatcatcttctgtgtggagctcagcggctacgacctgaaactctacgaggataaccagacaagtcggatggcagagagcttgcgcctctttgactccatctgcaacaacaactggttcatcaacacctcactcatcctcttcctgaacaagaaggacctgctggcagagaagatccgccgcatcccgctcaccatctgctttcccgagtacaagggccagaacacgtacgaggaggccgctgtctacatccagcggcagtttgaagacctgaaccgcaacaaggagaccaaggagatctactcccacttcacctgcgccaccgacaccagtaacatccagtttgtcttcgacgcggtgacagacgtcatcatacagaacaatctcaagtacattggcctttgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transient receptor potential cation channel, subfamily V, member 5
- Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
- UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
- COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)

Buy GNAZ-guanine nucleotide binding protein (G protein), alpha z polypeptide Gene now

Add to cart