Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene
PTXBC034740
New product
Data sheet of TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034740 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRPV5 |
| Origin species: | Human |
| Product name: | TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC034740 |
| Gene id: | 56302 |
| Gene description: | transient receptor potential cation channel, subfamily V, member 5 |
| Synonyms: | CAT2; ECAC1; OTRPC3; transient receptor potential cation channel subfamily V member 5; calcium transport protein 2; calcium transporter 2; epithelial calcium channel 1; osm-9-like TRP channel 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggttttctacctaaggcagaagggcccgggagccaactccagaaacttctgccctcctttctggtcagagaacaagactgggaccagcacctggacaagcttcatatgctgcagcagaagaggattctagagtctccactgcttcgagcatccaaggaaaatgacctgtctgttcttaggcaacttctactggactgcacctgtgacgttcgacaaagaggagccctgggggagacggcgctgcacatagcagccctctatgacaacttggaggcggccttggtgctgatggaggctgccccagagctggtctttgagcccaccacatgtgaggcttttgcaggtcagactgcactgcacatcgctgttgtgaaccagaatgtgaacctggtgcgtgccctgctcacccgcagggccagtgtctctgccagagccacaggcactgccttccgccatagtccccgcaacctcatctactttggggagcaccctttgtcctttgctgcctgtgtgaacagcgaggagatcgtgcggctgctcattgagcatggagctgacatcagggcccaggactccctgggaaacacagtattacacatcctcatcctccagcccaacaaaacctttgcctgccagatgtacaacctgctgctgtcctatgatggacatggggaccacctgcagcccctggaccttgtgcccaatcaccagggtctcacccccttcaagctggctggagtggagggtaacactgtgatgttccagcacctgatgcagaagcggaggcacatccagtggacgtatggacccctgacctccattctctacgacctcacggagatcgactcctggggagaggagctgtccttcctggagcttgtggtctcctctgataaacgagaggctcgccaaattctggaacagaccccagtgaaggagctggtgagcttcaagtggaacaagtatggccggccgtacttctgcatcctggctgccttgtacctgctctacatgatctgctttactacgtgctgcgtctaccgcccccttaagtttcgtggtggcaaccgcactcattctcgagacatcaccatcctccagcaaaaactactacaggtgattctcctcagaaggggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 - UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 - COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) - COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) |