TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene View larger

TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene

PTXBC034740

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034740
Product type: DNA & cDNA
Ncbi symbol: TRPV5
Origin species: Human
Product name: TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene
Size: 2ug
Accessions: BC034740
Gene id: 56302
Gene description: transient receptor potential cation channel, subfamily V, member 5
Synonyms: CAT2; ECAC1; OTRPC3; transient receptor potential cation channel subfamily V member 5; calcium transport protein 2; calcium transporter 2; epithelial calcium channel 1; osm-9-like TRP channel 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggggttttctacctaaggcagaagggcccgggagccaactccagaaacttctgccctcctttctggtcagagaacaagactgggaccagcacctggacaagcttcatatgctgcagcagaagaggattctagagtctccactgcttcgagcatccaaggaaaatgacctgtctgttcttaggcaacttctactggactgcacctgtgacgttcgacaaagaggagccctgggggagacggcgctgcacatagcagccctctatgacaacttggaggcggccttggtgctgatggaggctgccccagagctggtctttgagcccaccacatgtgaggcttttgcaggtcagactgcactgcacatcgctgttgtgaaccagaatgtgaacctggtgcgtgccctgctcacccgcagggccagtgtctctgccagagccacaggcactgccttccgccatagtccccgcaacctcatctactttggggagcaccctttgtcctttgctgcctgtgtgaacagcgaggagatcgtgcggctgctcattgagcatggagctgacatcagggcccaggactccctgggaaacacagtattacacatcctcatcctccagcccaacaaaacctttgcctgccagatgtacaacctgctgctgtcctatgatggacatggggaccacctgcagcccctggaccttgtgcccaatcaccagggtctcacccccttcaagctggctggagtggagggtaacactgtgatgttccagcacctgatgcagaagcggaggcacatccagtggacgtatggacccctgacctccattctctacgacctcacggagatcgactcctggggagaggagctgtccttcctggagcttgtggtctcctctgataaacgagaggctcgccaaattctggaacagaccccagtgaaggagctggtgagcttcaagtggaacaagtatggccggccgtacttctgcatcctggctgccttgtacctgctctacatgatctgctttactacgtgctgcgtctaccgcccccttaagtttcgtggtggcaaccgcactcattctcgagacatcaccatcctccagcaaaaactactacaggtgattctcctcagaaggggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
- UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
- COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
- COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)

Buy TRPV5-transient receptor potential cation channel, subfamily V, member 5 Gene now

Add to cart