Login to display prices
Login to display prices
COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene View larger

COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene

PTXBC012629

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012629
Product type: DNA & cDNA
Ncbi symbol: COPS2
Origin species: Human
Product name: COPS2-COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) Gene
Size: 2ug
Accessions: BC012629
Gene id: 9318
Gene description: COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
Synonyms: ALIEN; CSN2; SGN2; TRIP15; COP9 signalosome complex subunit 2; COP9 constitutive photomorphogenic homolog subunit 2; JAB1-containing signalosome subunit 2; TR-interacting protein 15; TRIP-15; alien homolog; signalosome subunit 2; thyroid receptor-interacting protein 15; COP9 signalosome subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgacatggaggatgatttcatgtgcgatgatgaggaggactacgacctggaatactctgaagatagtaactccgagccaaatgtggatttggaaaatcagtactataattccaaagcattaaaagaagatgacccaaaagcggcattaagcagtttccaaaaggttttggaacttgaaggtgaaaaaggagaatggggatttaaagcactgaaacaaatgattaagattaacttcaagttgacaaactttccagaaatgatgaatagatataagcagctattgacctatattcggagtgcagtcacaagaaattattctgaaaaatccattaattctattcttgattatatctctacttctaaacagatggatttactgcaggaattctatgaaacaacactggaagctttgaaagatgctaagaatgatagactgtggtttaagacaaacacaaagcttggaaaattatatttagaacgagaggaatatggaaagcttcaaaaaattttacgccagttacatcagtcgtgccagactgatgatggagaagatgatctgaaaaaaggtacacagttattagaaatatatgctttggaaattcaaatgtacacagcacagaaaaataacaaaaaacttaaagcactctatgaacagtcacttcacatcaagtctgccatccctcatccactgattatgggagttatcagagaatgtggtggtaaaatgcacttgagggaaggtgaatttgaaaaggcacacactgatttttttgaagccttcaagaattatgatgaatctggaagtccaagacgaaccacttgcttaaaatatttggtcttagcaaatatgcttatgaaatcgggaataaatccatttgactcacaggaggccaagccgtacaaaaatgatccagaaattttagcaatgacgaatttagtaagtgcctatcagaataatgacatcactgaatttgaaaagattctaaaaacaaatcacagcaacatcatggatgatcctttcataagagaacacattgaagagcttttgcgaaacatcagaacacaagtgcttataaaattaattaagccttacacaagaatacatattccttttatttctaaggagttaaacatagatgtagctgatgtggagagcttgctggtgcagtgcatattggataacactattcatggccgaattgatcaagtcaaccaactccttgaactggatcatcagaagaggggtggtgcacgatatactgcactagataaatggaccaaccaactaaattctctcaaccaggctgtagtcagtaaactggcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
- ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
- hepatoma-derived growth factor (high-mobility group protein 1-like)
- Src homology 3 domain-containing guanine nucleotide exchange factor