Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene
PTXBC021233
New product
Data sheet of ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021233 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP5O |
| Origin species: | Human |
| Product name: | ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene |
| Size: | 2ug |
| Accessions: | BC021233 |
| Gene id: | 539 |
| Gene description: | ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit |
| Synonyms: | ATPO; HMC08D05; OSCP; ATP synthase subunit O, mitochondrial; human ATP synthase OSCP subunit; oligomycin sensitivity conferral protein oscp-like protein; oligomycin sensitivity conferring protein; ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgccccagcagtgtccgggctctcccggcaggtgcgatgcttcagtacctctgtggtcagaccatttgccaagcttgtgaggcctcctgttcaggtatacggtattgaaggtcgctatgccacagctctttattctgctgcatcaaaacagaataagctggagcaagtagaaaaggagttgttgagagtagcacaaatcctgaaggaacccaaagtggctgcttctgttttgaatccctatgtgaagcgttccattaaagtgaaaagcctaaatgacatcacagcaaaagagaggttctctcccctcactaccaacctgatcaatttgcttgctgaaaatggtcgattaagcaatacccaaggagtcgtttctgccttttctaccatgatgagtgtccatcgcggagaggtaccttgcacagtgacctctgcatctcctttagaagaagccacactctctgaattaaaaactgtcctcaagagcttcctaagtcaaggccaagtattgaaattggaggctaagactgatccgtcaatcttgggtggaatgattgtgcgcattggcgagaaatatgttgacatgtctgtcaagaccaagattcagaagctgggcagggctatgcgggagattgtctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hepatoma-derived growth factor (high-mobility group protein 1-like) - Src homology 3 domain-containing guanine nucleotide exchange factor - degenerative spermatocyte homolog 1, lipid desaturase (Drosophila) - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa |