Login to display prices
Login to display prices
ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene View larger

ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021233
Product type: DNA & cDNA
Ncbi symbol: ATP5O
Origin species: Human
Product name: ATP5O-ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit Gene
Size: 2ug
Accessions: BC021233
Gene id: 539
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Synonyms: ATPO; HMC08D05; OSCP; ATP synthase subunit O, mitochondrial; human ATP synthase OSCP subunit; oligomycin sensitivity conferral protein oscp-like protein; oligomycin sensitivity conferring protein; ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccccagcagtgtccgggctctcccggcaggtgcgatgcttcagtacctctgtggtcagaccatttgccaagcttgtgaggcctcctgttcaggtatacggtattgaaggtcgctatgccacagctctttattctgctgcatcaaaacagaataagctggagcaagtagaaaaggagttgttgagagtagcacaaatcctgaaggaacccaaagtggctgcttctgttttgaatccctatgtgaagcgttccattaaagtgaaaagcctaaatgacatcacagcaaaagagaggttctctcccctcactaccaacctgatcaatttgcttgctgaaaatggtcgattaagcaatacccaaggagtcgtttctgccttttctaccatgatgagtgtccatcgcggagaggtaccttgcacagtgacctctgcatctcctttagaagaagccacactctctgaattaaaaactgtcctcaagagcttcctaagtcaaggccaagtattgaaattggaggctaagactgatccgtcaatcttgggtggaatgattgtgcgcattggcgagaaatatgttgacatgtctgtcaagaccaagattcagaagctgggcagggctatgcgggagattgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hepatoma-derived growth factor (high-mobility group protein 1-like)
- Src homology 3 domain-containing guanine nucleotide exchange factor
- degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)
- eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa