Login to display prices
Login to display prices
DYRK1B-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B Gene View larger

DYRK1B-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B Gene


New product

Data sheet of DYRK1B-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DYRK1B-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018751
Product type: DNA & cDNA
Ncbi symbol: DYRK1B
Origin species: Human
Product name: DYRK1B-dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B Gene
Size: 2ug
Accessions: BC018751
Gene id: 9149
Gene description: dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B
Synonyms: AOMS3; MIRK; dual specificity tyrosine-phosphorylation-regulated kinase 1B; dual specificity tyrosine-(Y)-phosphorylation regulated kinase 1B; minibrain-related kinase; mirk protein kinase; dual specificity tyrosine phosphorylation regulated kinase 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgtcccaccgggccatggtcccttctctggcttcccagggccccaggagcacacgcaggtattgcctgatgtgcggctactgcctcggaggctgcccctggccttccgggatgcaacctcagccccgctgcgtaagctctctgtggacctcatcaagacctacaagcacatcaatgaggtatactatgcgaagaagaagcggcgggcccagcaggcgccaccccaggattcgagcaacaagaaggagaagaaggtcctgaaccatggttatgatgacgacaaccatgactacatcgtgcgcagtggcgagcgctggctggagcgctacgaaattgactcgctcattggcaaaggctcctttggccaggtggtgaaagcctatgatcatcagacccaggagcttgtggccatcaagatcatcaagaacaaaaaggctttcctgaaccaggcccagattgagctgcggctgctggagctgatgaaccagcatgacacggagatgaagtactatatagtacacctgaagcggcacttcatgttccggaaccacctgtgcctggtatttgagctgctgtcctacaacctgtacgacctcctgcgcaacacccacttccgcggcgtctcgctgaacctgacccggaagctggcgcagcagctctgcacggcactgctctttctggccacgcctgagctcagcatcattcactgcgacctcaagcccgaaaacatcttgctgtgcaaccccaagcgcagcgccatcaagattgtggacttcggcagctcctgccagcttggccagaggatctaccagtatatccagagccgcttctaccgctcacctgaggtgctcctgggcacaccctacgacctggccattgacatgtggtccctgggctgcatccttgtggagatgcacaccggagagcccctcttcagtggctccaatgaggtcgaccagatgaaccgcattgtggaggtgctgggcatcccaccggccgccatgctggaccaggcgcccaaggctcgcaagtactttgaacggctgcctgggggtggctggaccctacgaaggacgaaagaactcaggaaggattaccagggccccgggacacggcggctgcaggaggtgctgggcgtgcagacgggcgggcccgggggccggcgggcgggggagccgggccacagccccgccgactacctccgcttccaggacctggtgctgcgcatgctggagtatgagcccgccgcccgcatcagccccctgggggctctgcagcacggcttcttccgccgcacggccgacgaggccaccaacacgggcccggcaggcagcagtgcctccacctcgcccgcgcccctcgacacctgcccctcttccagcaccgccagctccatctccagttctggaggctccagtggctcctccagtgacaaccggacctaccgctacagcaaccgatattgtgggggccctgggccccctatcacagactgtgagatgaacagcccccaggtcccaccctcccagccgctgcggccctgggcagggggtgatgtgccccacaagacacatcaagcccctgcctctgcctcgtcactgcctgggaccggggcccagttacccccccagccccgataccttggtcgtcccccatcaccaacctcaccaccacccccggagctgatggatgtgagcctggtgggcggccctgctgactgctccccacctcacccagcgcctgccccccagcacccggctgcctcagccctccggactcggatgactggaggtcgtccacccctcccgcctcctgatgaccctgccactctggggcctcacctgggcctccgtggtgtaccccagagcacagcagccagctcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
- hepatoma-derived growth factor (high-mobility group protein 1-like)
- Src homology 3 domain-containing guanine nucleotide exchange factor
- degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)