RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene View larger

RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030021
Product type: DNA & cDNA
Ncbi symbol: RASSF8
Origin species: Human
Product name: RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene
Size: 2ug
Accessions: BC030021
Gene id: 11228
Gene description: Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms: C12orf2; HOJ1; ras association domain-containing protein 8; Ras association (RalGDS/AF-6) domain family (N-terminal) member 8; carcinoma-associated protein HOJ-1; Ras association domain family member 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaacttaaagtatgggtggatggagttcagaggattgtttgtggagtcactgaagtcacaacttgccaggaggttgtcatagccttagctcaagcaataggtcgaactggaaggtacacccttatagagaaatggagagatactgaaagacacttagcacctcatgaaaatcctatcatatccttaaacaaatgggggcagtatgctagtgatgtgcagctcattctacgacgaactgggccgtctctcagtgagcgacccacttcagacagtgtggctcgaattcctgaaagaactttatacaggcagagtctgccccccttagctaaactgaggcctcagattgacaaatcaatcaaaaggagggaaccgaaaaggaaatcactgacatttacaggaggtgccaaaggattaatggacatttttggaaaaggtaaagaaactgagtttaagcaaaaggtgctgaataactgcaaaacaacagcagatgagttgaagaagctaatccgtctgcagacagagaagcttcaatccattgagaaacagctggaatctaatgaaatagaaataagattttgggagcaaaagtataattccaaccttgaagaggaaattgtccgtctagagcaaaagatcaaaagaaacgatgtagaaattgaggaggaagaattctgggaaaatgaattacagattgaacaggaaaatgaaaaacagctgaaggatcaacttcaagaaataagacagaaaataacagaatgtgaaaacaaattaaaggactatttggcacagatccggactatggaaagtggtcttgaagcagaaaaattgcaacgggaagttcaagaggcacaggtcaatgaggaagaggttaaaggaaagatcggtaaggtcaaaggggagattgacattcaaggccagcagagtctgaggttggaaaatggcatcaaagctgtggaaagatctcttggacaagccaccaaacgcttacaggacaaagaacaggaactggagcagttgactaaggagttgcggcaagtcaatctccagcagttcatccagcagacagggacaaaagttaccgttttgccagcggagcccattgaaatagaggcctcacatgcagacattgaaagggggatcatcattctttctgataagcaggagtgtaaagattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
- COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)
- COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)
- dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B

Buy RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene now

Add to cart