Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene
PTXBC030021
New product
Data sheet of RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030021 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RASSF8 |
| Origin species: | Human |
| Product name: | RASSF8-Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 Gene |
| Size: | 2ug |
| Accessions: | BC030021 |
| Gene id: | 11228 |
| Gene description: | Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 |
| Synonyms: | C12orf2; HOJ1; ras association domain-containing protein 8; Ras association (RalGDS/AF-6) domain family (N-terminal) member 8; carcinoma-associated protein HOJ-1; Ras association domain family member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacttaaagtatgggtggatggagttcagaggattgtttgtggagtcactgaagtcacaacttgccaggaggttgtcatagccttagctcaagcaataggtcgaactggaaggtacacccttatagagaaatggagagatactgaaagacacttagcacctcatgaaaatcctatcatatccttaaacaaatgggggcagtatgctagtgatgtgcagctcattctacgacgaactgggccgtctctcagtgagcgacccacttcagacagtgtggctcgaattcctgaaagaactttatacaggcagagtctgccccccttagctaaactgaggcctcagattgacaaatcaatcaaaaggagggaaccgaaaaggaaatcactgacatttacaggaggtgccaaaggattaatggacatttttggaaaaggtaaagaaactgagtttaagcaaaaggtgctgaataactgcaaaacaacagcagatgagttgaagaagctaatccgtctgcagacagagaagcttcaatccattgagaaacagctggaatctaatgaaatagaaataagattttgggagcaaaagtataattccaaccttgaagaggaaattgtccgtctagagcaaaagatcaaaagaaacgatgtagaaattgaggaggaagaattctgggaaaatgaattacagattgaacaggaaaatgaaaaacagctgaaggatcaacttcaagaaataagacagaaaataacagaatgtgaaaacaaattaaaggactatttggcacagatccggactatggaaagtggtcttgaagcagaaaaattgcaacgggaagttcaagaggcacaggtcaatgaggaagaggttaaaggaaagatcggtaaggtcaaaggggagattgacattcaaggccagcagagtctgaggttggaaaatggcatcaaagctgtggaaagatctcttggacaagccaccaaacgcttacaggacaaagaacaggaactggagcagttgactaaggagttgcggcaagtcaatctccagcagttcatccagcagacagggacaaaagttaccgttttgccagcggagcccattgaaatagaggcctcacatgcagacattgaaagggggatcatcattctttctgataagcaggagtgtaaagattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 - COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis) - COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis) - dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B |