Cart 1 Product Products 121,50 € (empty)
-
1 x ZAP70-zeta...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene
PTXBC009650
New product
Data sheet of PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009650 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDS5A |
| Origin species: | Human |
| Product name: | PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC009650 |
| Gene id: | 23244 |
| Gene description: | PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) |
| Synonyms: | PIG54; SCC-112; SCC112; sister chromatid cohesion protein PDS5 homolog A; PDS5, regulator of cohesion maintenance, homolog A; cell proliferation-inducing gene 54 protein; sister chromatid cohesion protein 112; PDS5 cohesin associated factor A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattcacctgctagcccatgatccagattttacaagatcacaagatgttgatcagcttcgtgatatcaaagagtgcctatggttcatgcttgaagttttaatgacaaagaatgaaaacaatagccatgcctttatgaagaagatggcagagaacatcaagttaaccagagatgcccagtctccagatgaatccaagacaaatgaaaaactgtatacagtatgtgatgtggctctctgtgttataaatagtaaaagtgctttgtgcaatgcagattcaccaaaggacccagtcctcccaatgaaattttttacacaacctgaaaaggacttctgtaacgataagagttatatttcagaagagacaagagtacttctgttaacaggaaagccaaagcctgctggagtactaggtgcagtaaataagcctttatcagcaacgggaaggaaaccctatgttagaagcactggcactgagactggaagcaatattaatgtaaattcagagctgaacccttcaaccggaaatcgatcaagggaacagagttcagaggcagcagaaactggagttagtgaaaatgaagagaaccctgtgaggattatttcagtcacacctgtaaagaatattgacccagtaaagaataaggaaattaattctgatcaggctacccagggcaacatcagcagtgaccgaggaaagaaaagaacagtaacagcagctggtgcagagaatatccaacaaaaaacagatgagaaagtagatgaatcgggacctcccgccccttccaaacccaggagaggacgtcgacccaagtctgaatctcagggcaatgctaccaaaaatgatgatctaaataaacctattaacaagggaaggaagagagctgcagtgggtcaggagagccctgggggtttggaagcaggtaatgccaaagcacccaaactgcaagatttagccaaaaaggcagcaccagcagaaagacaaattgacttacaaaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - guanine nucleotide binding protein (G protein), alpha z polypeptide - transient receptor potential cation channel, subfamily V, member 5 - Ras association (RalGDS/AF-6) domain family (N-terminal) member 8 - UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2 |