PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene View larger

PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene

PTXBC009650

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009650
Product type: DNA & cDNA
Ncbi symbol: PDS5A
Origin species: Human
Product name: PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009650
Gene id: 23244
Gene description: PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)
Synonyms: PIG54; SCC-112; SCC112; sister chromatid cohesion protein PDS5 homolog A; PDS5, regulator of cohesion maintenance, homolog A; cell proliferation-inducing gene 54 protein; sister chromatid cohesion protein 112; PDS5 cohesin associated factor A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattcacctgctagcccatgatccagattttacaagatcacaagatgttgatcagcttcgtgatatcaaagagtgcctatggttcatgcttgaagttttaatgacaaagaatgaaaacaatagccatgcctttatgaagaagatggcagagaacatcaagttaaccagagatgcccagtctccagatgaatccaagacaaatgaaaaactgtatacagtatgtgatgtggctctctgtgttataaatagtaaaagtgctttgtgcaatgcagattcaccaaaggacccagtcctcccaatgaaattttttacacaacctgaaaaggacttctgtaacgataagagttatatttcagaagagacaagagtacttctgttaacaggaaagccaaagcctgctggagtactaggtgcagtaaataagcctttatcagcaacgggaaggaaaccctatgttagaagcactggcactgagactggaagcaatattaatgtaaattcagagctgaacccttcaaccggaaatcgatcaagggaacagagttcagaggcagcagaaactggagttagtgaaaatgaagagaaccctgtgaggattatttcagtcacacctgtaaagaatattgacccagtaaagaataaggaaattaattctgatcaggctacccagggcaacatcagcagtgaccgaggaaagaaaagaacagtaacagcagctggtgcagagaatatccaacaaaaaacagatgagaaagtagatgaatcgggacctcccgccccttccaaacccaggagaggacgtcgacccaagtctgaatctcagggcaatgctaccaaaaatgatgatctaaataaacctattaacaagggaaggaagagagctgcagtgggtcaggagagccctgggggtttggaagcaggtaatgccaaagcacccaaactgcaagatttagccaaaaaggcagcaccagcagaaagacaaattgacttacaaaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - guanine nucleotide binding protein (G protein), alpha z polypeptide
- transient receptor potential cation channel, subfamily V, member 5
- Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
- UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2

Buy PDS5A-PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Gene now

Add to cart