Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MTHFD2L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like Gene
PTXBC032771
New product
Data sheet of MTHFD2L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MTHFD2L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032771 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MTHFD2L |
| Origin species: | Human |
| Product name: | MTHFD2L-methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like Gene |
| Size: | 2ug |
| Accessions: | BC032771 |
| Gene id: | 441024 |
| Gene description: | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like |
| Synonyms: | MTHFD2-like; NADP-dependent methylenetetrahydrofolate dehydrogenase 2-like protein; tetrahydrofolate dehydrogenase/cyclohydrolase; methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacccaagagtcagcggtatattagttcagttaccactaccagaccacgttgatgagcgaacaatatgcaatggaattgccccagaaaaagatgtagatggatttcatattatcaatattggaagattgtgccttgatcagcattctctcatacctgccactgccagtgctgtttgggaaataataaaaagaacaggaattcaaacatttggaaaaaatgtggttgtggctggaagatccaagaacgtagggatgcctattgccatgcttttacacactgatggagagcatgaacggccaggaggtgatgcaactgtgacaatagctcacagatacacccccaaagagcaactgaagattcatacgcagctggcagatattatcatagttgctgcagagagatttcaccattttgcccaggacctctccaactcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transient receptor potential cation channel, subfamily M, member 8 - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d - adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) |