TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene View larger

TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene

PTXBC001135

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001135
Product type: DNA & cDNA
Ncbi symbol: TRPM8
Origin species: Human
Product name: TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene
Size: 2ug
Accessions: BC001135
Gene id: 79054
Gene description: transient receptor potential cation channel, subfamily M, member 8
Synonyms: short form of the TRPM8 cationic channel; LTRPC6; TRPP8; transient receptor potential cation channel subfamily M member 8; LTrpC-6; long transient receptor potential channel 6; transient receptor melastatin 8 variant 1; transient receptor melastatin 8 variant 2; transient receptor potential p8; transient receptor potential subfamily M member 8; trp-p8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaatccttccttcctgtccacaccatcgtgcttatcagggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggcctgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgaggtaccggtgggacaggaggaggtctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
- adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae)
- PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)

Buy TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene now

Add to cart