Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene
PTXBC001135
New product
Data sheet of TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001135 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRPM8 |
| Origin species: | Human |
| Product name: | TRPM8-transient receptor potential cation channel, subfamily M, member 8 Gene |
| Size: | 2ug |
| Accessions: | BC001135 |
| Gene id: | 79054 |
| Gene description: | transient receptor potential cation channel, subfamily M, member 8 |
| Synonyms: | short form of the TRPM8 cationic channel; LTRPC6; TRPP8; transient receptor potential cation channel subfamily M member 8; LTrpC-6; long transient receptor potential channel 6; transient receptor melastatin 8 variant 1; transient receptor melastatin 8 variant 2; transient receptor potential p8; transient receptor potential subfamily M member 8; trp-p8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatccttccttcctgtccacaccatcgtgcttatcagggagaatgtgtgcaagtgtggctatgcccagagccagcacatggaaggcacccagatcaaccaaagtgagaaatggaactacaagaaacacaccaaggaatttcctaccgacgcctttggggatattcagtttgagacactggggaagaaagggaagtatatacgtctgtcctgcgacacggacgcggaaatcctttacgagctgctgacccagcactggcacctgaaaacacccaacctggtcatttctgtgaccgggggcgccaagaacttcgccctgaagccgcgcatgcgcaagatcttcagccggctcatctacatcgcgcagtccaaaggtgcttggattctcacgggaggcacccattatggcctgatgaagtacatcggggaggtggtgagagataacaccatcagcaggagttcagaggagaatattgtggccattggcatagcagcttggggcatggtctccaaccgggacaccctcatcaggaattgcgatgctgaggtaccggtgggacaggaggaggtctgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa - ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d - adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae) - PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) |