Login to display prices
Login to display prices
ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene View larger

ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000046
Product type: DNA & cDNA
Ncbi symbol: ICAM4
Origin species: Human
Product name: ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene
Size: 2ug
Accessions: BC000046
Gene id: 3386
Gene description: intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Synonyms: CD242; intercellular adhesion molecule 4; CD242 antigen; LW antigen a; Landsteiner-Wiener blood group antigen a; Landsteiner-Wiener blood group glycoprotein; intercellular adhesion molecule 4 (LW blood group); intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggtctctgttccctctgtcgctgctgttttttttggcggccgcctacccgggagttgggagcgcgctgggacgccggactaagcgggcgcaaagccccaagggtagccctctcgcgccctccgggacctcagtgcccttctgggtgcgcatgagcccggagttcgtggctgtgcagccggggaagtcagtgcagctcaattgcagcaacagctgtccccagccgcagaattccagcctccgcaccccgctgcggcaaggcaagacgctcagagggccgggttgggtgtcttaccagctgctcgacgtgagggcctggagctccctcgcgcactgcctcgtgacctgcgcaggaaaaacacgctgggccacctccaggatcaccgcctacagtgttcccggtgggctacttggtggtgaccctgaggcatggaagccgggtcatctattccgaaagcctggagcgcttcaccggcctggatctggccaacgtgaccttgacctacgagtttgctgctggaccccgcgacttctggcagcccgtgatctgccacgcgcgcctcaatctcgacggcctggtggtccgcaacagctcggcacccattacactgatgctcgcttggagccccgcgcccacagctttggcctccggttccatcgctgcccttgtagggatcctcctcactgtgggcgctgcgtacctatgcaagtgcctagctatgaagtcccaggcgtaaagggggatgttctatgccggctgagcgagaaaaagaggaatatgaaacaatctggggaaatggccatacatggtggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - required for meiotic nuclear division 5 homolog A (S. cerevisiae)
- protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
- integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
- methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like