Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene
PTXBC000046
New product
Data sheet of ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000046 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ICAM4 |
| Origin species: | Human |
| Product name: | ICAM4-intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) Gene |
| Size: | 2ug |
| Accessions: | BC000046 |
| Gene id: | 3386 |
| Gene description: | intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) |
| Synonyms: | CD242; intercellular adhesion molecule 4; CD242 antigen; LW antigen a; Landsteiner-Wiener blood group antigen a; Landsteiner-Wiener blood group glycoprotein; intercellular adhesion molecule 4 (LW blood group); intercellular adhesion molecule 4 (Landsteiner-Wiener blood group) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtctctgttccctctgtcgctgctgttttttttggcggccgcctacccgggagttgggagcgcgctgggacgccggactaagcgggcgcaaagccccaagggtagccctctcgcgccctccgggacctcagtgcccttctgggtgcgcatgagcccggagttcgtggctgtgcagccggggaagtcagtgcagctcaattgcagcaacagctgtccccagccgcagaattccagcctccgcaccccgctgcggcaaggcaagacgctcagagggccgggttgggtgtcttaccagctgctcgacgtgagggcctggagctccctcgcgcactgcctcgtgacctgcgcaggaaaaacacgctgggccacctccaggatcaccgcctacagtgttcccggtgggctacttggtggtgaccctgaggcatggaagccgggtcatctattccgaaagcctggagcgcttcaccggcctggatctggccaacgtgaccttgacctacgagtttgctgctggaccccgcgacttctggcagcccgtgatctgccacgcgcgcctcaatctcgacggcctggtggtccgcaacagctcggcacccattacactgatgctcgcttggagccccgcgcccacagctttggcctccggttccatcgctgcccttgtagggatcctcctcactgtgggcgctgcgtacctatgcaagtgcctagctatgaagtcccaggcgtaaagggggatgttctatgccggctgagcgagaaaaagaggaatatgaaacaatctggggaaatggccatacatggtggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - required for meiotic nuclear division 5 homolog A (S. cerevisiae) - protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase - integrin, beta 2 (complement component 3 receptor 3 and 4 subunit) - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like |