RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene View larger

RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012165
Product type: DNA & cDNA
Ncbi symbol: RMND5A
Origin species: Human
Product name: RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012165
Gene id: 64795
Gene description: required for meiotic nuclear division 5 homolog A (S. cerevisiae)
Synonyms: CTLH; GID2; GID2A; RMD5; p44CTLH; protein RMD5 homolog A; 44-kD protein coding for CTLH motif; C-terminal to LisH motif, 44 kDa; GID complex subunit 2 homolog A; required for meiotic nuclear division 5 homolog A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcagtgcgtgacggtggagcgcgagctggagaaggtgctgcacaagttctcaggctacgggcagctgtgcgagcgcggcctggaggagctcatcgactacaccggcggcctcaagcacgagatcctgcagagccacggccaagatgctgaattatcagggacactttcacttgttttgacacagtgctgtaaaagaataaaggatactgttcaaaaattggcctccgaccacaaagacatccacagcagtgtttctcgggttggaaaagccattgataagaattttgattctgacattagcagtgtgggaatagatggctgctggcaggcagacagccaaaggcttctcaatgaagtgatggtggagcacttctttcgacaaggaatgctggatgtggctgaggagctctgtcaggaatctggtctttctgtagacccaagtcagaaggaaccatttgtggagttaaatagaatattagaggcattaaaggtcagagttctgagacctgctctggagtgggcagtgtcaaaccgggaaatgcttatagctcaaaacagctccttggaatttaagctacacagactgtattttattagcttgttaatgggtggaaccacaaatcagcgagaggcattacaatatgctaaaaattttcagccatttgccctaaatcatcaaaaagacattcaggttttgatgggaagccttgtgtacctgagacaagggattgagaactcaccatatgttcacctacttgatgcaaaccagtgggctgatatctgtgacatctttacacgggatgcttgtgccctcctggggctctccgtggagtcccctctcagtgtcagtttctcagcaggttgtgtggcgctgccagctttaattaacatcaaagccgtgattgaacagaggcagtgtactggagtttggaaccagaaagatgaattacctattgaagtggaccttggtaaaaagtgctggtatcactctatatttgcctgccccattcttcgtcagcaaacaacagataacaatccacccatgaaattggtctgtggtcatattatatcaagagatgccctgaataaaatgtttaatggtagcaaattaaaatgtccctactgtccaatggaacaaagtccaggagatgccaaacagatatttttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase
- integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)
- methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
- transient receptor potential cation channel, subfamily M, member 8

Buy RMND5A-required for meiotic nuclear division 5 homolog A (S. cerevisiae) Gene now

Add to cart