ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene View larger

ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene

PTXBC015128

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015128
Product type: DNA & cDNA
Ncbi symbol: ATP5L
Origin species: Human
Product name: ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene
Size: 2ug
Accessions: BC015128
Gene id: 10632
Gene description: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G
Synonyms: ATP5JG; ATP synthase subunit g, mitochondrial; ATP synthase g chain, mitochondrial; ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G; ATP synthase, H+ transporting, mitochondrial F1F0, subunit g; ATPase subunit G; F1F0-type ATP synthase subunit g; F1Fo-ATP synthase complex Fo membrane domain g subunit; ATP synthase, H+ transporting, mitochondrial Fo complex subunit G
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccaatttgtccgtaaccttgtggagaagaccccggcgctggtgaacgctgctgtgacttactcgaagcctcgattggccacattttggtactacgccaaggttgagctggttcctcccacccctgctgagatccctagagctattcagagcctgaaaaaaatagccaatagtgctcagactggtagcttcaaacagctcacagttaaggaagctgtgctgaatggtttggtggccactgaggtgttgatgtggttttatgtcggagagattataggcaagcggggcatcattggctatgatgtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of inner mitochondrial membrane 17 homolog B (yeast)
- COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis)
- intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)
- required for meiotic nuclear division 5 homolog A (S. cerevisiae)

Buy ATP5L-ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G Gene now

Add to cart