EIF2S2-eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Gene View larger

EIF2S2-eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Gene

PTXBC000461

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EIF2S2-eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EIF2S2-eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000461
Product type: DNA & cDNA
Ncbi symbol: EIF2S2
Origin species: Human
Product name: EIF2S2-eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Gene
Size: 2ug
Accessions: BC000461
Gene id: 8894
Gene description: eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa
Synonyms: EIF2; EIF2B; EIF2beta; PPP1R67; eIF-2-beta; eukaryotic translation initiation factor 2 subunit 2; eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa; protein phosphatase 1, regulatory subunit 67; eukaryotic translation initiation factor 2 subunit beta
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggggacgagatgatttttgatcctactatgagcaagaagaaaaagaagaagaagaagccttttatgttagatgaggaaggggatacccaaacagaggaaacccagccttcagaaacaaaagaagtggagccagagccaactgaggacaaggatttggaagctgatgaagaggacactaggaaaaaagatgcttctgatgatctagatgacttgaacttctttaatcaaaagaaaaagaagaaaaaaactaaaaagatatttgatattgatgaagctgaagaaggtgtaaaggatcttaagattgaaagtgatgttcaagaaccaactgaaccagaggatgaccttgacattatgcttggcaataaaaagaagaaaaagaagaatgttaagttcccagatgaggatgaaatactagagaaagatgaagctctagaagatgaagacaacaaaaaagatgatggtatctcattcagtaatcagacaggccctgcttgggcaggctcagaaagagactacacatacgaggagctgctgaatcgagtgttcaacatcatgagggaaaagaatccagatatggttgctggggagaaaaggaaatttgtcatgaaacctccacaagtcgtccgagtaggaaccaagaaaacttcttttgtcaactttacagatatctgtaaactattacatcgtcagcccaaacatctccttgcatttttgttggctgaattgggtacaagtggttctatagatggtaataaccaacttgtaatcaaaggaagattccaacagaaacagatagaaaatgtcttgagaagatatatcaaggaatatgtcacttgtcacacatgccgatcaccggacacaatcctgcagaaggacacacgactctatttcctacagtgcgaaacttgtcattctagatgttctgttgccagtatcaaaaccggcttccaggctgtcacgggcaagcgagcacagctccgtgccaaagctaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis)
- required for meiotic nuclear division 5 homolog B (S. cerevisiae)
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit E
- ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G

Buy EIF2S2-eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Gene now

Add to cart