Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene
PTXBC008445
New product
Data sheet of MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008445 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MLLT11 |
| Origin species: | Human |
| Product name: | MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene |
| Size: | 2ug |
| Accessions: | BC008445 |
| Gene id: | 10962 |
| Gene description: | myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 |
| Synonyms: | AF1Q; protein AF1q; ALL1 fused gene from chromosome 1q; myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11; myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagggaccctgtgagtagccagtacagttcctttcttttctggaggatgcccatcccagaactggatctgtcggagctggaaggcctgggtctgtcagatacagccacctacaaggtcaaagacagcagcgttggcaaaatgatcgggcaagcaactgcagcagaccaggagaaaaaccctgaaggtgatggcctccttgagtacagcaccttcaacttctggagagctcccattgccagcatccactccttcgaactggacttgctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 - serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 - thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) - nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein |