Login to display prices
Login to display prices
MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene View larger

MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene

PTXBC008445

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008445
Product type: DNA & cDNA
Ncbi symbol: MLLT11
Origin species: Human
Product name: MLLT11-myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila), translocated to, 11 Gene
Size: 2ug
Accessions: BC008445
Gene id: 10962
Gene description: myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11
Synonyms: AF1Q; protein AF1q; ALL1 fused gene from chromosome 1q; myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11; myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagggaccctgtgagtagccagtacagttcctttcttttctggaggatgcccatcccagaactggatctgtcggagctggaaggcctgggtctgtcagatacagccacctacaaggtcaaagacagcagcgttggcaaaatgatcgggcaagcaactgcagcagaccaggagaaaaaccctgaaggtgatggcctccttgagtacagcaccttcaacttctggagagctcccattgccagcatccactccttcgaactggacttgctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
- serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2
- thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)
- nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein