Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NFATC2IP-nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein Gene
PTXBC018311
New product
Data sheet of NFATC2IP-nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NFATC2IP-nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018311 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NFATC2IP |
| Origin species: | Human |
| Product name: | NFATC2IP-nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC018311 |
| Gene id: | 84901 |
| Gene description: | nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein |
| Synonyms: | ESC2; NIP45; RAD60; NFATC2-interacting protein; 45 kDa NF-AT-interacting protein; 45 kDa NFAT-interacting protein; nuclear factor of activated T-cells, cytoplasmic 2-interacting protein; nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein; nuclear factor of activated T-cells 2 interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggagcccctgcagagtgtggtggaccacatggccacccaccttggggtgtccccaagcaggatccttttgctttttggagagacagagctatcacctactgccactcccaggaccctaaagctcggagtggctgacatcattgactgtgtggtactaacaagttctccagaggccacagagacgtcccaacagctccagctccgggtgcagggaaaggagaaacaccagacactggaagtctcactgtctcgagattcccctctaaagaccctcatgtcccactatgaggaggccatgggactgtcgggacggaagctctccttcttctttgatgggacaaagctttcaggcagggagctgccagctgacctgggcatggaatctggggacctcattgaggtctggggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 - homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 - solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1) - platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) |