HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene View larger

HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene

PTXBC000086

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000086
Product type: DNA & cDNA
Ncbi symbol: HERPUD1
Origin species: Human
Product name: HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene
Size: 2ug
Accessions: BC000086
Gene id: 9709
Gene description: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: HERP; Mif1; SUP; homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein; MMS-inducible; homocysteine-inducible endoplasmic reticulum stress-inducible ubiquitin-like domain member 1 protein; homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1; methyl methanesulfonate (MMF)-inducible fragment protein 1; homocysteine inducible ER protein with ubiquitin like domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtccgagaccgaacccgagcccgtcacgctcctggtgaagagccccaaccagcgccaccgcgacttggagctgagtggcgaccgcggctggagtgtgggccacctcaaggcccacctgagccgcgtctaccccgagcgtccgcgtccagaggaccagaggttaatttattctgggaagctgttgttggatcaccaatgtctcagggacttgcttccaaagcaggaaaaacggcatgttttgcatctggtgtgcaatgtgaagagtccttcaaaaatgccagaaatcaacgccaaggtggctgaatccacagaggagcctgctggttctaatcggggacagtatcctgaggattcctcaagtgatggtttaaggcaaagggaagttcttcggaacctttcttcccctggatgggaaaacatctcaaggcctgaagctgcccagcaggcattccaaggcctgggtcctggtttctccggttacacaccctatgggtggcttcagctttcctggttccagcagatatatgcacgacagtactacatgcaatatttagcagccactgctgcatcaggggcttttgttccaccaccaagtgcacaagagatacctgtggtctctgcacctgctccagcccctattcacaaccagtttccagctgaaaaccagcctgccaatcagaatgctgctcctcaagtggttgttaatcctggagccaatcaaaatttgcggatgaatgcacaaggtggccctattgtggaagaagatgatgaaataaatcgagattggttggattggacctattcagcagctacattttctgtttttctcagtatcctctacttctactcctccctgagcagattcctcatggtcatgggggccaccgttgttatgtacctgcatcacgttgggtggtttccatttagaccgaggccggttcagaacttcccaaatgatggtcctcctcctgacgttgtaaatcaggaccccaacaataacttacaggaaggcactgatcctgaaactgaagaccccaaccacctccctccagacagggatgtactagatggcgagcagaccagcccctcctttatgagcacagcatggcttgtcttcaagactttctttgcctctcttcttccagaaggccccccagccatcgcaaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)
- platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)
- BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31

Buy HERPUD1-homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 Gene now

Add to cart