No products
Prices are tax excluded
PTXBC016743
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016743 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BRF1 |
| Origin species: | Human |
| Product name: | BRF1-BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC016743 |
| Gene id: | 2972 |
| Gene description: | BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) |
| Synonyms: | BRF1, RNA polymerase III transcription initiation factor subunit; BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit; BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB; BRF; BRF-1; CFDS; GTF3B; HEL-S-76p; TAF3B2; TAF3C; TAFIII90; TF3B90; TFIIIB90; hBRF; transcription factor IIIB 90 kDa subunit; B - related factor 1; TATA box binding protein (TBP)-associated factor 3C; TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2; TBP - associated factor, RNA polymerase III, 90kD; epididymis secretory sperm binding protein Li 76p; general transcription factor IIIB, 90kD subunit |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgggccgcgtgtgccgcggttgcggcggcacggacatcgagctggacgcggcgcgcggggacgcggtgtgcaccgcctgcggctcagtgctggaggacaacatcatcgtgtccgaggtgcagttcgtggagagcagcggcggcggctcctcggccgtgggccagttcgtgtccctggacggtgctggcaaaaccccgactctgggtggcggcttccacgtgaatctggggaaggagtcgagagcgcagaccctgcagaatgggaggcgccacatccaccacctggggaaccagctgcagctgaaccagcactgcctggacaccgccttcaacttcttcaagatggccgtgagcaggcacctgacccgcggccggaagatggcccacgtgattgctgcctgcctctacctggtctgccgtacggagggcacgccgcacatgctcctggacctcagcgacctgctccaggtagacagcctccgtcctgcatctttccccacctggggttgtgacctgggggttgtgaccagggttgtgaccggggtgtaccccaggtgcctccacgcatctcagtggccggtctgtgctgcctgcccggtcaggaagttttggtctgtaggatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31 - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6) - 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) |