Login to display prices
Login to display prices
BRF1-BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gene View larger

BRF1-BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BRF1-BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BRF1-BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016743
Product type: DNA & cDNA
Ncbi symbol: BRF1
Origin species: Human
Product name: BRF1-BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gene
Size: 2ug
Accessions: BC016743
Gene id: 2972
Gene description: BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
Synonyms: BRF1, RNA polymerase III transcription initiation factor subunit; BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit; BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB; BRF; BRF-1; CFDS; GTF3B; HEL-S-76p; TAF3B2; TAF3C; TAFIII90; TF3B90; TFIIIB90; hBRF; transcription factor IIIB 90 kDa subunit; B - related factor 1; TATA box binding protein (TBP)-associated factor 3C; TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2; TBP - associated factor, RNA polymerase III, 90kD; epididymis secretory sperm binding protein Li 76p; general transcription factor IIIB, 90kD subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgggccgcgtgtgccgcggttgcggcggcacggacatcgagctggacgcggcgcgcggggacgcggtgtgcaccgcctgcggctcagtgctggaggacaacatcatcgtgtccgaggtgcagttcgtggagagcagcggcggcggctcctcggccgtgggccagttcgtgtccctggacggtgctggcaaaaccccgactctgggtggcggcttccacgtgaatctggggaaggagtcgagagcgcagaccctgcagaatgggaggcgccacatccaccacctggggaaccagctgcagctgaaccagcactgcctggacaccgccttcaacttcttcaagatggccgtgagcaggcacctgacccgcggccggaagatggcccacgtgattgctgcctgcctctacctggtctgccgtacggagggcacgccgcacatgctcctggacctcagcgacctgctccaggtagacagcctccgtcctgcatctttccccacctggggttgtgacctgggggttgtgaccagggttgtgaccggggtgtaccccaggtgcctccacgcatctcagtggccggtctgtgctgcctgcccggtcaggaagttttggtctgtaggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)
- 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)