ABHD14B-abhydrolase domain containing 14B Gene View larger

ABHD14B-abhydrolase domain containing 14B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD14B-abhydrolase domain containing 14B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD14B-abhydrolase domain containing 14B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007234
Product type: DNA & cDNA
Ncbi symbol: ABHD14B
Origin species: Human
Product name: ABHD14B-abhydrolase domain containing 14B Gene
Size: 2ug
Accessions: BC007234
Gene id: 84836
Gene description: abhydrolase domain containing 14B
Synonyms: protein ABHD14B; CIB; HEL-S-299; CCG1-interacting factor B; abhydrolase domain-containing protein 14B; alpha/beta hydrolase domain-containing protein 14B; cell cycle gene 1-interacting factor B; epididymis secretory protein Li 299; abhydrolase domain containing 14B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcaagcgtggagcagcgcgagggcaccatccaggtgcagggccaggccctcttcttccgagaggccctgcccggcagtgggcaggctcgcttctctgtactgctgctgcatggtattcgcttctcctccgagacctggcagaacctgggtacactgcacaggctggcccaggctggctaccgggctgtggccattgacctgccaggtctggggcactccaaggaagcagcagcccctgcccctattggggagctggcccctggcagcttcctggcggctgtggtggatgccttggagctgggccccccggttgtgatcagtccatcactgagtggcatgtactccctgcccttcctcacggcccctggctcccagctcccgggctttgtgccagtggcccccatctgcactgacaaaatcaatgctgccaactatgccagtgtgaagactccagctctgattgtatatggagaccaggaccccatgggtcagaccagctttgagcacctgaagcagctgcccaaccaccgggtgctgatcatgaagggggcggggcacccctgttacctggacaaaccagaggagtggcatacagggctgctggacttcctgcaggggctccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAB39B, member RAS oncogene family
- RAB11A, member RAS oncogene family
- D-2-hydroxyglutarate dehydrogenase
- inhibitor of growth family, member 5

Buy ABHD14B-abhydrolase domain containing 14B Gene now

Add to cart