CLEC1A-C-type lectin domain family 1, member A Gene View larger

CLEC1A-C-type lectin domain family 1, member A Gene

PTXBC039072

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLEC1A-C-type lectin domain family 1, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CLEC1A-C-type lectin domain family 1, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039072
Product type: DNA & cDNA
Ncbi symbol: CLEC1A
Origin species: Human
Product name: CLEC1A-C-type lectin domain family 1, member A Gene
Size: 2ug
Accessions: BC039072
Gene id: 51267
Gene description: C-type lectin domain family 1, member A
Synonyms: CLEC-1; CLEC1; C-type lectin domain family 1 member A; C-type lectin-like receptor-1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggccaagtacagcagcacgagggacatgctggatgatgatggggacaccaccatgagcctgcattctcaaggctctgccacaactcggcatccagagccccggcgcacagagcacagggctccctcttcaacgtggcgaccagtggccctgaccctgctgactttgtgcttggtgctgctgatagggctggcagccctggggcttttgttttttcagtactaccagctctccaatactggtcaagacaccatttctcaaatggaagaaagattaggaaatacgtcccaagagttgcaatctcttcaagtccagaatataaagcttgcaggaagtctgcagcatgtggctgaaaaactctgtcgtgagctgtataacaaagctggagcacacaggtgcagcccttgtacagaacaatggaaatggcatggagacaattgctaccagttctataaagacagcaaaagttgggaggactgtaaatatttctgccttagtgaaaactctaccatgctgaagataaacaaacaagaagacctggaatttgccgcgtctcagagctactctgagtttttctactcttattggacagggcttttgcgccctgacagtggcaaggcctggctgtggatggatggaacccctttcacttctgaactgttccatattataatagatgtcaccagcccaagaagcagagactgtgtggccatccttaatgggatgatcttctcaaaggactgcaaagaattgaagcgttgtgtctgtgagagaagggcaggaatggtgaagccagagagcctccatgtcccccctgaaacattaggcgaaggtgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 2,4-dienoyl CoA reductase 2, peroxisomal
- DiGeorge syndrome critical region gene 8
- chromosome 14 open reading frame 100
- cytokine induced apoptosis inhibitor 1

Buy CLEC1A-C-type lectin domain family 1, member A Gene now

Add to cart