Login to display prices
Login to display prices
DGCR8-DiGeorge syndrome critical region gene 8 Gene View larger

DGCR8-DiGeorge syndrome critical region gene 8 Gene

PTXBC009984

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DGCR8-DiGeorge syndrome critical region gene 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DGCR8-DiGeorge syndrome critical region gene 8 Gene

Proteogenix catalog: PTXBC009984
Ncbi symbol: DGCR8
Product name: DGCR8-DiGeorge syndrome critical region gene 8 Gene
Size: 2ug
Accessions: BC009984
Gene id: 54487
Gene description: DiGeorge syndrome critical region gene 8
Synonyms: DGCR8, microprocessor complex subunit; microprocessor complex subunit DGCR8; C22orf12; DGCRK6; Gy1; pasha; DiGeorge syndrome critical region 8; DiGeorge syndrome critical region gene 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacagatgagagcccctctccgctcccgtgtgggcccgcaggagaagcggtgatggagagccgagctcgccccttccaagcgctgccccgtgagcagtctccaccacctcccctgcaaacgtccagtggtgcagaggtaatggacgttggctctggtggtgatggacagtccgaactccctgctgaggaccccttcaacttctacggagcttctcttctctccaaaggatccttctctaagggccgcctcctcatagacccgaactgtagtggccacagcccgcgcaccgcccggcacgcacctgcggtccggaagttctcccctgaccttaagttgcttaaggatgtaaagattagcgtgagctttaccgagagctgcaggagtaaggacaggaaggtgctgtacacaggagcagagcgcgacgtgcgggcggagtgcggtctgctccttagccctgtcagtggggacgtgcatgcttgtccctttggcgggagtgttggtgacggggtaggcatagggggtgagagtgctgataagaaggatgaggagaatgagctggatcaggaaaagagagtggagtatgcagtgctcgatgagttagaagattttactgacaatttggagctagatgaagaaggagcaggcgggttcacggctaaagcaatcgttcagagagacagagtggatgaagaggccttgaatttcccctacgaggatgactttgacaacgatgtggatgctctgctggaagaaggcctttgtgcccccaaaaagaggcgaacagaggaaaaatatggcggagacagcgaccatccgtccgatggagagacaagtgtgcagccgatgatgaccaagattaaaacagtgctcaaaagtcgtggccgcccacctacagagcctgttctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: