DGCR8-DiGeorge syndrome critical region gene 8 Gene View larger

DGCR8-DiGeorge syndrome critical region gene 8 Gene

PTXBC009984

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DGCR8-DiGeorge syndrome critical region gene 8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DGCR8-DiGeorge syndrome critical region gene 8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009984
Product type: DNA & cDNA
Ncbi symbol: DGCR8
Origin species: Human
Product name: DGCR8-DiGeorge syndrome critical region gene 8 Gene
Size: 2ug
Accessions: BC009984
Gene id: 54487
Gene description: DiGeorge syndrome critical region gene 8
Synonyms: DGCR8, microprocessor complex subunit; microprocessor complex subunit DGCR8; C22orf12; DGCRK6; Gy1; pasha; DiGeorge syndrome critical region 8; DiGeorge syndrome critical region gene 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacagatgagagcccctctccgctcccgtgtgggcccgcaggagaagcggtgatggagagccgagctcgccccttccaagcgctgccccgtgagcagtctccaccacctcccctgcaaacgtccagtggtgcagaggtaatggacgttggctctggtggtgatggacagtccgaactccctgctgaggaccccttcaacttctacggagcttctcttctctccaaaggatccttctctaagggccgcctcctcatagacccgaactgtagtggccacagcccgcgcaccgcccggcacgcacctgcggtccggaagttctcccctgaccttaagttgcttaaggatgtaaagattagcgtgagctttaccgagagctgcaggagtaaggacaggaaggtgctgtacacaggagcagagcgcgacgtgcgggcggagtgcggtctgctccttagccctgtcagtggggacgtgcatgcttgtccctttggcgggagtgttggtgacggggtaggcatagggggtgagagtgctgataagaaggatgaggagaatgagctggatcaggaaaagagagtggagtatgcagtgctcgatgagttagaagattttactgacaatttggagctagatgaagaaggagcaggcgggttcacggctaaagcaatcgttcagagagacagagtggatgaagaggccttgaatttcccctacgaggatgactttgacaacgatgtggatgctctgctggaagaaggcctttgtgcccccaaaaagaggcgaacagaggaaaaatatggcggagacagcgaccatccgtccgatggagagacaagtgtgcagccgatgatgaccaagattaaaacagtgctcaaaagtcgtggccgcccacctacagagcctgttctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 100
- cytokine induced apoptosis inhibitor 1
- polymerase (RNA) I polypeptide C, 30kDa
- TRAF and TNF receptor associated protein

Buy DGCR8-DiGeorge syndrome critical region gene 8 Gene now

Add to cart