CIDEC-cell death-inducing DFFA-like effector c Gene View larger

CIDEC-cell death-inducing DFFA-like effector c Gene

PTXBC016851

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CIDEC-cell death-inducing DFFA-like effector c Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CIDEC-cell death-inducing DFFA-like effector c Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016851
Product type: DNA & cDNA
Ncbi symbol: CIDEC
Origin species: Human
Product name: CIDEC-cell death-inducing DFFA-like effector c Gene
Size: 2ug
Accessions: BC016851
Gene id: 63924
Gene description: cell death-inducing DFFA-like effector c
Synonyms: CIDE-3; CIDE3; FPLD5; FSP27; cell death activator CIDE-3; fat specific protein 27; cell death inducing DFFA like effector c
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatacgccatgaagtcccttagccttctgtaccccaagtccctctccaggcatgtgtcagtgcgtacctctgtggtgacccagcagctgctgtcggagcccagccccaaggcccccagggcccggccctgccgcgtaagcacggcggatcgaagcgtgaggaagggcatcatggcttacagtcttgaggacctcctcctcaaggtccgggacactctgatgctggcagacaagcccttcttcctggtgctggaggaagatggcacaactgtagagacagaagagtacttccaagccctggcaggggatacagtgttcatggtcctccagaaggggcagaaatggcagcccccatcagaacaggggacaaggcacccactgtccctctcccataagcctgccaagaagattgatgtggcccgtgtaacgtttgatctgtacaagctgaacccacaggacttcattggctgcctgaacgtgaaggcgactttttatgatacatactccctttcctatgatctgcactgctgtggggccaagcgcatcatgaaggaagctttccgctgggccctcttcagcatgcaggccacaggccacgtactgcttggcacctcctgttacctgcagcagctcctcgatgctacggaggaagggcagccccccaagggcaaggcctcatcccttatcccgacctgtctgaagatactgcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 2,4-dienoyl CoA reductase 2, peroxisomal
- fragile X mental retardation 1 neighbor
- cytokine inducible SH2-containing protein
- rapamycin-insensitive companion of mTOR

Buy CIDEC-cell death-inducing DFFA-like effector c Gene now

Add to cart