RICTOR-rapamycin-insensitive companion of mTOR Gene View larger

RICTOR-rapamycin-insensitive companion of mTOR Gene

PTXBC029608

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RICTOR-rapamycin-insensitive companion of mTOR Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RICTOR-rapamycin-insensitive companion of mTOR Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029608
Product type: DNA & cDNA
Ncbi symbol: RICTOR
Origin species: Human
Product name: RICTOR-rapamycin-insensitive companion of mTOR Gene
Size: 2ug
Accessions: BC029608
Gene id: 253260
Gene description: rapamycin-insensitive companion of mTOR
Synonyms: AVO3; PIA; hAVO3; rapamycin-insensitive companion of mTOR; AVO3 homolog; TORC2-specific protein AVO3; pianissimo; RPTOR independent companion of MTOR complex 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgatcggccgcggccgctctctgaagaacctccgagtacgagggcggaatgacagcggcgaggagaacgtcccgctggatctgacccgagaaccttctgataacttaagagagattctccaaaatgtggccagattgcagggagtatcaaatatgagaaagctaggccatctgaataactttactaagcttctttgtgatattggccacagtgaagaaaaactgggctttcactatgaggatatcataatttgtttgcggttagctttattaaatgaagcaaaagaagtgcgagcagcagggctacgagcgcttcgatatctcatccaagactccagtattctccagaaggtgctaaaattgaaagtggactatttaatagctaggtgcattgacatacaacagagcaacgaggtagagaggacacaagcacttcgattagtcagaaagatgattactgtgaatgcttccttgtttcctagttctgtgaccaactcattaattgcagttggaaatgatggacttcaagaaagagacagaatggtccgagcatgcattgccattatctgtgaactagcacttcagaatccagaggtggtggcccttcgaggtggactaaacaccatcttgaaaaatgtgatcgattgccaattaagtcgaataaatgaggccctaattactacaattttgcaccttcttaatcatccaaagactcgacagtatgtgcgagctgatgtagaattagaggtaggaactttaatattcttttctagttttaaaatattattataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - C-type lectin domain family 1, member A
- 2,4-dienoyl CoA reductase 2, peroxisomal
- DiGeorge syndrome critical region gene 8
- chromosome 14 open reading frame 100

Buy RICTOR-rapamycin-insensitive companion of mTOR Gene now

Add to cart