Login to display prices
Login to display prices
DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene View larger

DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene

PTXBC010740

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene

Proteogenix catalog: PTXBC010740
Ncbi symbol: DECR2
Product name: DECR2-2,4-dienoyl CoA reductase 2, peroxisomal Gene
Size: 2ug
Accessions: BC010740
Gene id: 26063
Gene description: 2,4-dienoyl CoA reductase 2, peroxisomal
Synonyms: PDCR; SDR17C1; peroxisomal 2,4-dienoyl-CoA reductase; 2,4-dienoyl-CoA reductase 2, peroxisomal; short chain dehydrogenase/reductase family 17C member 1; 2,4-dienoyl-CoA reductase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccagccgccgcccgacgtggagggggacgactgtctccccgcgtaccgccacctcttctgcccggacctgctgcgggacaaagtggccttcatcacaggaggcggctctgggattgggttccggattgctgagattttcatgcggcacggctgccatacggtgattgccagtaggagcctgccgcgagtgctgacggccgccaggaagctggctggggccaccggccggcgctgcctccctctctctatggacgtccgagcgcccccagctgtcatggccgccgtggaccaggctctgaaggagtttggcagaatcgacattctcattaactgtgcggccgggaacttcctgtgccccgctggcgccttgtccttcaacgccttcaagaccgtgatggacatcgataccagcggcaccttcaatgtgtctcgtgtgctctatgagaagttcttccgggaccacggaggggtgatcgtgaacatcactgccaccctggggaaccgggggcaggcgctccaggtgcatgcaggctccgccaaggccgctgtggacgcgatgacgcggcacttggctgtggagtggggtccccaaaacatccgcgtcaacagcctcgcccctggccccatcagtggcacagaggggctccggcgactgggtggccctcaagccagcctgagcaccaaggtcactgccagcccgctgcagaggctggggaacaagaccgagatcgcccacagcgtgctctacctggccagccctctggcttcctacgtgacgggggccgtgctggtggccgatggcggggcatggttgacgttcccaaacggtgtcaaagggctgccggatttcgcatccttctctgctaagctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: