CISH-cytokine inducible SH2-containing protein Gene View larger

CISH-cytokine inducible SH2-containing protein Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CISH-cytokine inducible SH2-containing protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CISH-cytokine inducible SH2-containing protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031590
Product type: DNA & cDNA
Ncbi symbol: CISH
Origin species: Human
Product name: CISH-cytokine inducible SH2-containing protein Gene
Size: 2ug
Accessions: BC031590
Gene id: 1154
Gene description: cytokine inducible SH2-containing protein
Synonyms: BACTS2; CIS; CIS-1; G18; SOCS; cytokine-inducible SH2-containing protein; cytokine-inducible inhibitor of signaling type 1B; suppressor of cytokine signaling; cytokine inducible SH2 containing protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtcctctgcgttcagggacctcgtcctttgctggctgtggagcggactgggcagcggcccctgtgggccccgtccctggaactgcccaagccagtcatgcagcccttgcctgctggggccttcctcgaggaggtggcagagggtaccccagcccagacagagagtgagccaaaggtgctggacccagaggaggatctgctgtgcatagccaagaccttctcctaccttcgggaatctggctggtattggggttccattacggccagcgaggcccgacaacacctgcagaagatgccagaaggcacgttcttagtacgtgacagcacgcaccccagctacctgttcacgctgtcagtgaaaaccactcgtggccccaccaatgtacgcattgagtatgctgactccagcttccgtctggactccaactgcttgtccaggccacgcatcctggcctttccggatgtggtcagccttgtgcagcactatgtggcctcctgcactgctgatacccgaagcgacagccccgatcctgctcccaccccggccctgcctatgcctaaggaggatgcgcctagtgacccagcactgcctgctcctccaccagccactgctgtacacctaaaactggtgcagccctttgtacgcagaagcagcgcccgcagcctgcaacacctgtgccgccttgtcatcaaccgtctggtggccgacgtggactgcctgccactgccccggcgcatggccgactacctccgacagtaccccttccagctctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - rapamycin-insensitive companion of mTOR
- C-type lectin domain family 1, member A
- 2,4-dienoyl CoA reductase 2, peroxisomal
- DiGeorge syndrome critical region gene 8

Buy CISH-cytokine inducible SH2-containing protein Gene now

Add to cart