Cart 6 Product Products 1 126,89 € (empty)
-
1 x TRIM13-tri...121,50 € -
-
1 x Donkey...213,10 € -
1 x Donkey...239,00 € -
1 x Donkey...239,00 € -
No products
To be determined Shipping
1 126,89 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 126,89 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 126,89 €
View larger 
Data sheet of CISH-cytokine inducible SH2-containing protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CISH-cytokine inducible SH2-containing protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031590 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CISH |
| Origin species: | Human |
| Product name: | CISH-cytokine inducible SH2-containing protein Gene |
| Size: | 2ug |
| Accessions: | BC031590 |
| Gene id: | 1154 |
| Gene description: | cytokine inducible SH2-containing protein |
| Synonyms: | BACTS2; CIS; CIS-1; G18; SOCS; cytokine-inducible SH2-containing protein; cytokine-inducible inhibitor of signaling type 1B; suppressor of cytokine signaling; cytokine inducible SH2 containing protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcctctgcgttcagggacctcgtcctttgctggctgtggagcggactgggcagcggcccctgtgggccccgtccctggaactgcccaagccagtcatgcagcccttgcctgctggggccttcctcgaggaggtggcagagggtaccccagcccagacagagagtgagccaaaggtgctggacccagaggaggatctgctgtgcatagccaagaccttctcctaccttcgggaatctggctggtattggggttccattacggccagcgaggcccgacaacacctgcagaagatgccagaaggcacgttcttagtacgtgacagcacgcaccccagctacctgttcacgctgtcagtgaaaaccactcgtggccccaccaatgtacgcattgagtatgctgactccagcttccgtctggactccaactgcttgtccaggccacgcatcctggcctttccggatgtggtcagccttgtgcagcactatgtggcctcctgcactgctgatacccgaagcgacagccccgatcctgctcccaccccggccctgcctatgcctaaggaggatgcgcctagtgacccagcactgcctgctcctccaccagccactgctgtacacctaaaactggtgcagccctttgtacgcagaagcagcgcccgcagcctgcaacacctgtgccgccttgtcatcaaccgtctggtggccgacgtggactgcctgccactgccccggcgcatggccgactacctccgacagtaccccttccagctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - rapamycin-insensitive companion of mTOR - C-type lectin domain family 1, member A - 2,4-dienoyl CoA reductase 2, peroxisomal - DiGeorge syndrome critical region gene 8 |