FMR1NB-fragile X mental retardation 1 neighbor Gene View larger

FMR1NB-fragile X mental retardation 1 neighbor Gene

PTXBC034320

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FMR1NB-fragile X mental retardation 1 neighbor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FMR1NB-fragile X mental retardation 1 neighbor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034320
Product type: DNA & cDNA
Ncbi symbol: FMR1NB
Origin species: Human
Product name: FMR1NB-fragile X mental retardation 1 neighbor Gene
Size: 2ug
Accessions: BC034320
Gene id: 158521
Gene description: fragile X mental retardation 1 neighbor
Synonyms: CT37; NY-SAR-35; NYSAR35; fragile X mental retardation 1 neighbor protein; cancer/testis antigen 37; sarcoma antigen NY-SAR-35; fragile X mental retardation 1 neighbor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcttcacataggaggaaagcgaaggggaggaataggagaagtcaccgtgccatgcgtgtggctcacttagagctggcaacttatgagttggcggcaactgagtcgaatcccgagagcagccatcctggatacgaggccgccatggctgacaggcctcagccaggatggcgggaatctctaaagatgcgggtcagcaaaccctttgggatgctcatgctctccatttggatcctgctgttcgtgtgctactacctgtcctactacctgtgctccgggtcctcatattttgtgcttgcaaatggacatatcctgcccaacagtgaaaatgctcatggccaatctctggaagaagattccgcattggaagctttgctgaattttttctttccaacaacttgcaatctgagggaaaatcaggtggcaaagccttgtaatgagctgcaagatcttagtgagagtgaatgtttgagacacaaatgctgtttttcatcatcggggaccacgagcttcaaatgttttgctccatttagagatgtgcctaaacagatgatgcaaatgtttgggcttggtgcgatcagccttatcctggtatgtctgcccatttattgccgctctcttttctggaggagcgaaccggccgatgatttacaaaggcaggacaacagagttgtaacgggtttgaagaaacaaagaaggaagcgaaagaggaagtctgaaatgttacagaaagcagcaagaggacgtgaggaacatggtgacgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytokine inducible SH2-containing protein
- rapamycin-insensitive companion of mTOR
- C-type lectin domain family 1, member A
- 2,4-dienoyl CoA reductase 2, peroxisomal

Buy FMR1NB-fragile X mental retardation 1 neighbor Gene now

Add to cart