PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene View larger

PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene

PTXBC029822

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029822
Product type: DNA & cDNA
Ncbi symbol: PDGFB
Origin species: Human
Product name: PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene
Size: 2ug
Accessions: BC029822
Gene id: 5155
Gene description: platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog)
Synonyms: IBGC5; PDGF-2; PDGF2; SIS; SSV; c-sis; platelet-derived growth factor subunit B; PDGF subunit B; PDGF, B chain; becaplermin; platelet-derived growth factor 2; platelet-derived growth factor B chain; platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog); platelet-derived growth factor, beta polypeptide (oncogene SIS); proto-oncogene c-Sis; platelet derived growth factor subunit B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcgctgctgggcgctcttcctgtctctctgctgctacctgcgtctggtcagcgccgagggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcctttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccgagttggacctgaacatgacccgctcccactctggaggcgagctggagagcttggctcgtggaagaaggagcctgggttccctgaccattgctgagccggccatgatcgccgagtgcaagacgcgcaccgaggtgttcgagatctcccggcgcctcatagaccgcaccaacgccaacttcctggtgtggccgccctgtgtggaggtgcagcgctgctccggctgctgcaacaaccgcaacgtgcagtgccgccccacccaggtgcagctgcgacctgtccaggtgagaaagatcgagattgtgcggaagaagccaatctttaagaaggccacggtgacgctggaagaccacctggcatgcaagtgtgagacagtggcagctgcacggcctgtgacccgaagcccggggggttcccaggagcagcgagccaaaacgccccaaactcgggtgaccattcggacggtgcgagtccgccggccccccaagggcaagcaccggaaattcaagcacacgcatgacaagacggcactgaaggagacccttggagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)
- solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4)
- UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)

Buy PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene now

Add to cart