Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene
PTXBC029822
New product
Data sheet of PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029822 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDGFB |
| Origin species: | Human |
| Product name: | PDGFB-platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) Gene |
| Size: | 2ug |
| Accessions: | BC029822 |
| Gene id: | 5155 |
| Gene description: | platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) |
| Synonyms: | IBGC5; PDGF-2; PDGF2; SIS; SSV; c-sis; platelet-derived growth factor subunit B; PDGF subunit B; PDGF, B chain; becaplermin; platelet-derived growth factor 2; platelet-derived growth factor B chain; platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog); platelet-derived growth factor, beta polypeptide (oncogene SIS); proto-oncogene c-Sis; platelet derived growth factor subunit B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatcgctgctgggcgctcttcctgtctctctgctgctacctgcgtctggtcagcgccgagggggaccccattcccgaggagctttatgagatgctgagtgaccactcgatccgctcctttgatgatctccaacgcctgctgcacggagaccccggagaggaagatggggccgagttggacctgaacatgacccgctcccactctggaggcgagctggagagcttggctcgtggaagaaggagcctgggttccctgaccattgctgagccggccatgatcgccgagtgcaagacgcgcaccgaggtgttcgagatctcccggcgcctcatagaccgcaccaacgccaacttcctggtgtggccgccctgtgtggaggtgcagcgctgctccggctgctgcaacaaccgcaacgtgcagtgccgccccacccaggtgcagctgcgacctgtccaggtgagaaagatcgagattgtgcggaagaagccaatctttaagaaggccacggtgacgctggaagaccacctggcatgcaagtgtgagacagtggcagctgcacggcctgtgacccgaagcccggggggttcccaggagcagcgagccaaaacgccccaaactcgggtgaccattcggacggtgcgagtccgccggccccccaagggcaagcaccggaaattcaagcacacgcatgacaagacggcactgaaggagacccttggagcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) - solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 31 - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4 (GalNAc-T4) - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6) |