SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene View larger

SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene

PTXBC015663

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015663
Product type: DNA & cDNA
Ncbi symbol: SERPINE2
Origin species: Human
Product name: SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene
Size: 2ug
Accessions: BC015663
Gene id: 5270
Gene description: serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2
Synonyms: GDN; GDNPF; PI-7; PI7; PN-1; PN1; PNI; glia-derived nexin; glial-derived neurite promoting factor; peptidase inhibitor 7; protease nexin I; serpin E2; serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2; serpin family E member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactggcatctccccctcttcctcttggcctctgtgacgctgccttccatctgctcccacttcaatcctctgtctctcgaggaactaggctccaacacggggatccaggttttcaatcagattgtgaagtcgaggcctcatgacaacatcgtgatctctccccatgggattgcgtcggtcctggggatgcttcagctgggggcggacggcaggaccaagaagcagctcgccatggtgatgagatacggcgtaaatggagttggtaaaatattaaagaagatcaacaaggccatcgtctccaagaagaataaagacattgtgacagtggctaacgccgtgtttgttaagaatgcctctgaaattgaagtgccttttgttacaaggaacaaagatgtgttccagtgtgaggtccggaatgtgaactttgaggatccagcctctgcctgtgattccatcaatgcatgggttaaaaatgaaaccagggatatgattgacaatctgctgtccccagatcttattgatggtgtgctcaccagactggtcctcgtcaacgcagtgtatttcaagggtctgtggaaatcacggttccaacccgagaacacaaagaaacgcactttcgtggcagccgacgggaaatcctatcaagtgccaatgctggcccagctctccgtgttccggtgtgggtcgacaagtgcccccaatgatttatggtacaacttcattgaactgccctaccacggggaaagcatcagcatgctgattgcactgccgactgagagctccactccgctgtctgccatcatcccacacatcagcaccaagaccatagacagctggatgagcatcatggtgcccaagagggtgcaggtgatcctgcccaagttcacagctgtagcacaaacagatttgaaggagccgctgaaagttcttggcattactgacatgtttgattcatcaaaggcaaattttgcaaaaataacaacagggtcagaaaacctccatgtttctcatatcttgcaaaaagcaaaaattgaagtcagtgaagatggaaccaaagcttcagcagcaacaactgcaattctcattgcaagatcatcgcctccctggtttatagtagacagaccttttctgtttttcatccgacataatcctacaggtgctgtgttattcatggggcagataaacaaaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)
- nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
- homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
- homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1

Buy SERPINE2-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 Gene now

Add to cart