Login to display prices
Login to display prices
SERPINE1-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Gene View larger

SERPINE1-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Gene

PTXBC010860

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERPINE1-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERPINE1-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010860
Product type: DNA & cDNA
Ncbi symbol: SERPINE1
Origin species: Human
Product name: SERPINE1-serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 Gene
Size: 2ug
Accessions: BC010860
Gene id: 5054
Gene description: serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagatgtctccagccctcacctgcctagtcctgggcctggcccttgtctttggtgaagggtctgctgtgcaccatcccccatcctacgtggcccacctggcctcagacttcggggtgagggtgtttcagcaggtggcgcaggcctccaaggaccgcaacgtggttttctcaccctatggggtggcctcggtgttggccatgctccagctgacaacaggaggagaaacccagcagcagattcaagcagctatgggattcaagattgatgacaagggcatggcccccgccctccggcatctgtacaaggagctcatggggccatggaacaaggatgagatcagcaccacagacgcgatcttcgtccagcgggatctgaagctggtccagggcttcatgccccacttcttcaggctgttccggagcacggtcaagcaagtggacttttcagaggtggagagagccagattcatcatcaatgactgggtgaagacacacacaaaaggtatgatcagcaacttgcttgggaaaggagccgtggaccagctgacacggctggtgctggtgaatgccctctacttcaacggccagtggaagactcccttccccgactccagcacccaccgccgcctcttccacaaatcagacggcagcactgtctctgtgcccatgatggctcagaccaacaagttcaactatactgagttcaccacgcccgatggccattactacgacatcctggaactgccctaccacggggacaccctcagcatgttcattgctgccccttatgaaaaagaggtgcctctctctgccctcaccaacattctgagtgcccagctcatcagccactggaaaggcaacatgaccaggctgccccgcctcctggttctgcccaagttctccctggagactgaagtcgacctcaggaagcccctagagaacctgggaatgaccgacatgttcagacagtttcaggctgacttcacgagtctttcagaccaagagcctctccacgtcgcgcaggcgctgcagaaagtgaagatcgaggtgaacgagagtggcacggtggcctcctcatccacagctgtcatagtctcagcccgcatggcccccgaggagatcatcatggacagacccttcctctttgtggtccggcacaaccccacaggaacagtccttttcatgggccaagtgatggaaccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2
- thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)
- nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
- homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1