Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene
PTXBC000884
New product
Data sheet of SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000884 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPCS1 |
| Origin species: | Human |
| Product name: | SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC000884 |
| Gene id: | 28972 |
| Gene description: | signal peptidase complex subunit 1 homolog (S. cerevisiae) |
| Synonyms: | HSPC033; SPC1; SPC12; YJR010C-A; signal peptidase complex subunit 1; SPase 12 kDa subunit; microsomal signal peptidase 12 kDa subunit; signal peptidase 12kDa; signal peptidase complex 12 kDa subunit; signal peptidase complex subunit 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctggagcatctgagctcgctgcccacgcagatggattacaagggccagaagctagctgaacagatgtttcagggaattattcttttttctgcaatagttggatttatctacgggtacgtggctgaacagttcgggtggactgtctatatagttatggccggatttgctttttcatgtttggcccagctgacacttcctccatggcccatctatcgccggcatcctctcaagtggttacctgttcaagaatcaagcacagacgacaagaaaccaggggaaagaaaaattaagaggcatgctaaaaataattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, regulatory (inhibitor) subunit 1B - solute carrier family 26 (sulfate transporter), member 1 - ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 - DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) |