Login to display prices
Login to display prices
SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene View larger

SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000884
Product type: DNA & cDNA
Ncbi symbol: SPCS1
Origin species: Human
Product name: SPCS1-signal peptidase complex subunit 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC000884
Gene id: 28972
Gene description: signal peptidase complex subunit 1 homolog (S. cerevisiae)
Synonyms: HSPC033; SPC1; SPC12; YJR010C-A; signal peptidase complex subunit 1; SPase 12 kDa subunit; microsomal signal peptidase 12 kDa subunit; signal peptidase 12kDa; signal peptidase complex 12 kDa subunit; signal peptidase complex subunit 1 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggagcatctgagctcgctgcccacgcagatggattacaagggccagaagctagctgaacagatgtttcagggaattattcttttttctgcaatagttggatttatctacgggtacgtggctgaacagttcgggtggactgtctatatagttatggccggatttgctttttcatgtttggcccagctgacacttcctccatggcccatctatcgccggcatcctctcaagtggttacctgttcaagaatcaagcacagacgacaagaaaccaggggaaagaaaaattaagaggcatgctaaaaataattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein phosphatase 1, regulatory (inhibitor) subunit 1B
- solute carrier family 26 (sulfate transporter), member 1
- ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
- DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)