Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene
PTXBC010874
New product
Data sheet of DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010874 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DIMT1L |
| Origin species: | Human |
| Product name: | DIMT1L-DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC010874 |
| Gene id: | 27292 |
| Gene description: | DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) |
| Synonyms: | DIMT1L; DIM1; HSA9761; HUSSY5; 18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase; 18S rRNA dimethylase; DIM1 dimethyladenosine transferase 1-like; S-adenosylmethionine-6-N',N'-adenosyl(rRNA) dimethyltransferase; dimethyladenosine transferase; DIM1 dimethyladenosine transferase 1 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgaaggtcaagtcgggggccatcggccgccgccgcgggcggcaggagcagcgccgggagctgaagagcgctggaggactcatgttcaacacggggattgggcagcacattttgaaaaatcctctcattattaacagcattatcgataaggctgccttaagaccaactgatgtagtgctggaagttggacctggaactggcaacatgactgtaaagttgttagaaaaggcaaaaaaggttgttgcttgtgaacttgacccaaggctagtagctgaacttcacaaaagagttcagggcacgcctgtggccagcaaacttcaagtactggtgggtgatgtgctgaaaacagatttgccattctttgatacttgtgtggcaaatttgccttatcagatctcttcgccttttgtcttcaagctgttgctacatcgaccttttttcaggtgtgctatacttatgtttcaaagagaatttgccctccgactggttgcaaaacctggagataagttatactgcagactctcaattaatacacagctgttggcacgtgtggaccatctaatgaaagtgggaaagaataacttcagaccaccgcccaaggtggaatccagtgttgtaaggatagaacctaagaatccaccaccacccatcaattttcaggaatgggatggtctagtaaggataacctttgttaggaaaaacaagacactctctgctgcatttaaatcaagtgcagtgcaacaactcttggaaaaaaactacagaattcactgttcagtccataatattataataccagaagatttcagcatagcagataaaatacagcaaatcctaaccagcacaggttttagtgacaaacgggcccgttccatggacatagatgacttcatcagattgctacatggattcaacgcagaaggtattcatttttcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 - sterile alpha motif and leucine zipper containing kinase AZK - protein C (inactivator of coagulation factors Va and VIIIa) |