Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ZAK-sterile alpha motif and leucine zipper containing kinase AZK Gene
PTXBC001401
New product
Data sheet of ZAK-sterile alpha motif and leucine zipper containing kinase AZK Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZAK-sterile alpha motif and leucine zipper containing kinase AZK Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001401 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZAK |
| Origin species: | Human |
| Product name: | ZAK-sterile alpha motif and leucine zipper containing kinase AZK Gene |
| Size: | 2ug |
| Accessions: | BC001401 |
| Gene id: | 51776 |
| Gene description: | sterile alpha motif and leucine zipper containing kinase AZK |
| Synonyms: | ZAK; AZK; MLK7; MLT; MLTK; MLTKalpha; MLTKbeta; MRK; SFMMP; mlklak; mitogen-activated protein kinase kinase kinase MLT; HCCS-4; MLK-like mitogen-activated protein triple kinase; ZAK1 homolog, leucine zipper and sterile-alpha motif kinase; human cervical cancer suppressor gene 4 protein; mixed lineage kinase 7; mixed lineage kinase with a leucine zipper and a sterile alpha motif; mixed lineage kinase-related kinase MRK-beta; sterile alpha motif and leucine zipper containing kinase AZK; mitogen-activated protein kinase kinase kinase 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtctctcggtgcctcctttgtgcaaattaaatttgatgacttgcagttttttgaaaactgcggtggaggaagttttgggagtgtttatcgagccaaatggatatcacaggacaaggaggtggctgtaaagaagctcctcaaaatagagaaagaggcagaaatactcagtgtcctcagtcacagaaacatcatccagttttatggagtaattcttgaacctcccaactatggcattgtcacagaatatgcttctctgggatcactctatgattacattaacagtaacagaagtgaggagatggatatggatcacattatgacctgggccactgatgtagccaaaggaatgcattatttacatatggaggctcctgtcaaggtgattcacagagacctcaagtcaagaaacgttgttatagctgctgatggagtattgaagatctgtgactttggtgcctctcggttccataaccatacaacacacatgtccttggttggaactttcccatggatggctccagaagttatccagagtctccctgtgtcagaaacttgtgacacatattcctatggtgtggttctctgggagatgctaacaagggaggtcccctttaaaggtttggaaggattacaagtagcttggcttgtagtggaaaaaaacgagagattaaccattccaagcagttgccccagaagttttgctgaactgttacatcagtgttgggaagctgatgccaagaaacggccatcattcaagcaaatcatttcaatcctggagtccatgtcaaatgacacgagccttcctgacaagtgtaactcattcctacacaacaaggcggagtggaggtgcgaaattgaggcaactcttgagaggctaaagaaactagagcgtgatctcagctttaaggagcaggagcttaaagaacgagaaagacgtttaaagatgtgggagcaaaagctgacagagcagtccaacaccccgcttctcttgcctcttgctgcaagaatgtctgaggagtcttactttgaatctaaaacagaggagtcaaacagtgcagagatgtcatgtcagatcacagcaacaagtaacggggagggccatggcatgaacccaagtctgcaggccatgatgctgatgggctttggggatatcttctcaatgaacaaagcaggagctgtgatgcattctgggatgcagataaacatgcaagccaagcagaattcttccaaaaccacatctaagagaagggggaagaaagtcaacatggctctggggttcagtgattttgacttgtcagaaggtgacgatgatgatgatgatgacggtgaggaggaggataatgacatggataatagtgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein C (inactivator of coagulation factors Va and VIIIa) - v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 - lectin, galactoside-binding, soluble, 3 binding protein |