PSMD3-proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene View larger

PSMD3-proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene

PTXBC004859

New product

Data sheet of PSMD3-proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMD3-proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC004859
Product type: DNA & cDNA
Ncbi symbol: PSMD3
Origin species: Human
Product name: PSMD3-proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene
Size: 2ug
Accessions: BC004859
Gene id: 5709
Gene description: proteasome (prosome, macropain) 26S subunit, non-ATPase, 3
Synonyms: P58; RPN3; TSTA2; 26S proteasome non-ATPase regulatory subunit 3; 26S proteasome regulatory subunit RPN3; 26S proteasome regulatory subunit S3; proteasome (prosome, macropain) 26S subunit, non-ATPase, 3; proteasome subunit p58; tissue specific transplantation antigen 2; proteasome 26S subunit, non-ATPase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcaggagggctcggcgcggcgccgcggcgcggacaaggcgaaaccgccgcccggcggaggagaacaagaacccccaccgccgccggccccccaggatgtggagatgaaagaggaggcagcgacgggtggcgggtcaacgggggaggcagacggcaagacggcggcggcagcggctgagcactcccagcgagagctggacacagtcaccttggaggacatcaaggagcacgtgaaacagctagagaaagcggtttcaggcaaggagccgagattcgtgctgcgggccctgcggatgctgccttccacatcacgccgcctcaaccactatgttctgtataaggctgtgcagggcttcttcacttcaaataatgccactcgagactttttgctccccttcctggaagagcccatggacacagaggctgatttacagttccgtccccgcacgggaaaagctgcgtcgacacccctcctgcctgaagtggaagcctatctccaactcctcgtggtcatcttcatgatgaacagcaagcgctacaaagaggcacagaagatctctgatgatctgatgcagaagatcagtactcagaaccgccgggccctagaccttgtagccgcaaagtgttactattatcacgcccgggtctatgagttcctggacaagctggatgtggtgcgcagcttcttgcatgctcggctccggacagctacgcttcggcatgacgcagacgggcaggccaccctgttgaacctcctgctgcggaattacctacactacagcttgtacgaccaggctgagaagctggtgtccaagtctgtgttcccagagcaggccaacaacaacgagtgggccaggtacctctactacacagggcgaatcaaagccatccagctggagtactcagaggcccggagaacgatgaccaacgcccttcgcaaggcccctcagcacacagctgtcggcttcaaacagacggtgcacaagcttctcatcgtggtggagctgttgctgggggagatccctgaccggctgcagttccgccagccctccctcaagcgctcactcatgccctatttccttctgactcaagctgtcaggacaggaaacctagccaagttcaaccaggtcctggatcagtttggggagaagtttcaagcagatgggacctacaccctaattatccggctgcggcacaacgtgattaagacaggtgtacgcatgatcagcctctcctattcccgaatctccttggctgacatcgcccagaagctgcagttggatagccccgaagatgcagagttcattgttgccaaggccatccgggatggtgtcattgaggccagcatcaaccacgagaagggctatgtccaatccaaggagatgattgacatctattccacccgagagccccagctagccttccaccagcgcatctccttctgcctagatatccacaacatgtctgtcaaggccatgaggtttcctcccaaatcgtacaacaaggacttggagtctgcagaggaacggcgtgagcgagaacagcaggacttggagtttgccaaggagatggcagaagatgatgatgacagcttcccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lectin, galactoside-binding, soluble, 3 binding protein
- mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)
- polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa
- cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)

Buy PSMD3-proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene now

Add to cart