Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDKN2B-cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) Gene
PTXBC014469
New product
Data sheet of CDKN2B-cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDKN2B-cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014469 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDKN2B |
| Origin species: | Human |
| Product name: | CDKN2B-cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) Gene |
| Size: | 2ug |
| Accessions: | BC014469 |
| Gene id: | 1030 |
| Gene description: | cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) |
| Synonyms: | CDK4I; INK4B; MTS2; P15; TP15; p15INK4b; cyclin-dependent kinase 4 inhibitor B; CDK inhibitory protein; CDK4B inhibitor; MTS-2; cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4); cyclin-dependent kinases 4 and 6 binding protein; multiple tumor suppressor 2; p14-INK4b; p14_CDK inhibitor; p14_INK4B; p15 CDK inhibitor; p15-INK4b; p15_INK4B; cyclin dependent kinase inhibitor 2B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgcgaggagaacaagggcatgcccagtgggggcggcagcgatgagggtctggccagcgccgcggcgcggggactagtggagaaggtgcgacagctcctggaagccggcgcggatcccaacggagtcaaccgtttcgggaggcgcgcgatccaggtcatgatgatgggcagcgcccgcgtggcggagctgctgctgctccacggcgcggagcccaactgcgcagaccctgccactctcacccgaccggtgcatgatgctgcccgggagggcttcctggacacgctggtggtgctgcaccgggccggggcgcggctggacgtgcgcgatgcctggggtcgtctgcccgtggacttggccgaggagcggggccaccgcgacgttgcagggtacctgcgcacagccacgggggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - signaling lymphocytic activation molecule family member 1 - RCD1 required for cell differentiation1 homolog (S. pombe) - lectin, galactoside-binding, soluble, 3 binding protein - transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) |