Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RQCD1-RCD1 required for cell differentiation1 homolog (S. pombe) Gene
PTXBC007102
New product
Data sheet of RQCD1-RCD1 required for cell differentiation1 homolog (S. pombe) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RQCD1-RCD1 required for cell differentiation1 homolog (S. pombe) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007102 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RQCD1 |
| Origin species: | Human |
| Product name: | RQCD1-RCD1 required for cell differentiation1 homolog (S. pombe) Gene |
| Size: | 2ug |
| Accessions: | BC007102 |
| Gene id: | 9125 |
| Gene description: | RCD1 required for cell differentiation1 homolog (S. pombe) |
| Synonyms: | RQCD1; CAF40; CT129; RCD-1; RCD1; cell differentiation protein RCD1 homolog; RCD1 required for cell differentiation1 homolog; cancer/testis antigen 129; protein involved in sexual development; CCR4-NOT transcription complex subunit 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacagcctggcgacggctgcgcctgtgcctactacactggcacaagtggatagagaaaagatctatcagtggatcaatgagctgtccagtcctgagactagggaaaatgctttgctggagctaagtaagaagcgagaatctgttcctgaccttgcacccatgctgtggcattcatttggtactattgcagcacttttacaggaaattgtaaatatttatccatctatcaacccacccaccttgacagcacaccagtctaacagagtttgcaatgctctggcattactgcaatgtgtagcatcacatccagaaaccaggtcagcgtttctcgcagcacacatcccactttttttgtacccctttttgcacactgtcagcaaaacacgtccctttgagtatctccggctcaccagccttggagttactggggccctggtgaaaacagatgaacaagaagtaatcaactttttattaacaacagaaattatccctttatgtttgcgaattatggaatctggaagtgaactttctaaaacagttgccacattcatcctccagaagatcttgttagatgacactggtttggcttatatatgtcagacgtatgagcgtttctcccatgttgccatgatcttgggtaagatggtcctgcagctatccaaagagccttctgcccgtctgctgaagcatgtagtgagatgttaccttcgactttcagataaccccaggttttcagatttgactttctgctggtcatcttttcaaagaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lectin, galactoside-binding, soluble, 3 binding protein - transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 - mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) |