TAP2-transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene View larger

TAP2-transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene

PTXBC002751

New product

Data sheet of TAP2-transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TAP2-transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC002751
Product type: DNA & cDNA
Ncbi symbol: TAP2
Origin species: Human
Product name: TAP2-transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) Gene
Size: 2ug
Accessions: BC002751
Gene id: 6891
Gene description: transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
Synonyms: ABC18; ABCB3; APT2; D6S217E; PSF-2; PSF2; RING11; antigen peptide transporter 2; ABC transporter, MHC 2; ATP-binding cassette, sub-family B (MDR/TAP), member 3; peptide supply factor 2; peptide transporter PSF2; peptide transporter involved in antigen processing 2; really interesting new gene 11 protein; transporter 2, ABC (ATP binding cassette); transporter 2, ATP-binding cassette, sub-family B (MDR/TAP); transporter 2, ATP binding cassette subfamily B member
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggctccctgacctgagaccctggacctccctgctgctggtggacgcggctttactgtggctgcttcagggccctctggggactttgcttcctcaagggctgccaggactatggctggaggggaccctgcggctgggagggctgtgggggctgctaaagctaagagggctgctgggatttgtggggacactgctgctcccgctctgtctggccacccccctgactgtctccctgagagccctggtcgcgggggcctcacgtgctcccccagccagagtcgcttcagccccttggagctggctgctggtggggtacggggctgcggggctcagctggtcactgtgggctgttctgagccctcctggagcccaggagaaggagcaggaccaggtgaacaacaaagtcttgatgtggaggctgctgaagctctccaggccggacctgcctctcctcgttgccgccttcttcttccttgtccttgctgttttgggtgagacattaatccctcactattctggtcgtgtgattgacatcctgggaggtgattttgacccccatgcctttgccagtgccatcttcttcatgtgcctcttctcctttggcagctcactgtctgcaggctgccgaggaggctgcttcacctacaccatgtctcgaatcaacttgcggatccgggagcagcttttctcctccctgctgcgccaggacctcggtttcttccaggagactaagacaggggagctgaactcacggctgagctcggataccaccctgatgagtaactggcttcctttaaatgccaatgtgctcttgcgaagcctggtgaaagtggtggggctgtatggcttcatgctcagcatatcgcctcgactcaccctcctttctctgctgcacatgcccttcacaatagcagcggagaaggtgtacaacacccgccatcaggaagtgcttcgggagatccaggatgcagtggccagggcggggcaggtggtgcgggaagccgttggagggctgcagaccgttcgcagttttggggccgaggagcatgaagtctgtcgctataaagaggcccttgaacaatgtcggcagctgtattggcggagagacctggaacgcgccttgtacctgctcgtaaggagggtgctgcacttgggggtgcagatgctgatgctgagctgtgggctgcagcagatgcaggatggggagctcacccagggcagcctgctttcctttatgatctaccaggagagcgtggggagctatgtgcagaccctggtatacatatatggggatatgctcagcaacgtgggagctgcagagaaggttttctcctacatggaccgacagccaaatctgccttcacctggcacgcttgcccccaccactctgcagggggttgtgaaattccaagacgtctcctttgcatatcccaatcgccctgacaggcctgtgctcaaggggctgacgtttaccctacgtcctggtgaggtgacggcgctggtgggacccaatgggtctgggaagagcacagtggctgccctgctgcagaatctgtaccagcccacagggggacaggtgctgctggatgaaaagcccatctcacagtatgaacactgctacctgcacagccaggtggtttcagttgggcaggagcctgtgctgttctccggttctgtgaggaacaacattgcttatgggctgcagagctgcgaagatgataaggtgatggcggctgcccaggctgcccacgcagatgacttcatccaggaaatggagcatggaatatacacagatgtaggggagaagggaagccagctggctgcgggacagaaacaacgtctggccattgcccgggcccttgtacgagacccgcgggtcctcatcctggatgaggctactagtgccctagatgtgcagtgcgagcaggccctgcaggactggaattcccgtggggatcgcacagtgctggtgattgctcacaggctgcagacagttcagcgcgcccaccagatcctggtgctccaggagggcaagctgcagaagcttgcccagctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
- mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
- solute carrier family 1 (glutamate transporter), member 7
- protein phosphatase 1, regulatory (inhibitor) subunit 1A