Login to display prices
Login to display prices
SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene View larger

SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene

PTXBC000651

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene

Proteogenix catalog: PTXBC000651
Ncbi symbol: SLC1A7
Product name: SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene
Size: 2ug
Accessions: BC000651
Gene id: 6512
Gene description: solute carrier family 1 (glutamate transporter), member 7
Synonyms: AAAT; excitatory amino acid transporter 5; excitatory amino acid transporter 5 (retinal glutamate transporter); retinal glutamate transporter; solute carrier family 1 (glutamate transporter), member 7; solute carrier family 1 member 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgccgcatgccatcttggcacgggggagggacgtgtgcaggcggaatggactcctcatcctgtctgtgctgtctgtcatcgtgggctgcctcctcggcttcttcttgaggacccggcgcctctcaccacaggaaattagttacttccagttccctggagagctcctgatgaggatgctgaagatgatgatcctgccactggtggtctccagcttgatgtccggacttgcctccctggatgccaagacctctagccgcctgggcgtcctcaccgtggcgtactacctgtggaccaccttcatggctgtcatcgtgggcatcttcatggtctccatcatccacccaggcagcgcggcccagaaggagaccacggagcagagtgggaagcccatcatgagctcagccgatgccctgttggacctcatccggcagaaagaagaaagttggaggaacggaccaaagggtcctggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: