PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene View larger

PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022470
Product type: DNA & cDNA
Ncbi symbol: PPP1R1A
Origin species: Human
Product name: PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene
Size: 2ug
Accessions: BC022470
Gene id: 5502
Gene description: protein phosphatase 1, regulatory (inhibitor) subunit 1A
Synonyms: IPP1; protein phosphatase 1 regulatory subunit 1A; IPP-1; inhibitor-1; protein phosphatase inhibitor-1; protein phosphatase 1 regulatory inhibitor subunit 1A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcaagacaacagcccccaaaagatccagttcacggtcccgctgctggagccgcaccttgaccccgaggcggcggagcagattcggaggcgccgccccacccctgccaccctcgtgctgaccagtgaccagtcatccccagagatagatgaagaccggatccccaacccacatctcaagtccactttggcaatgtctccacggcaacggaagaagatgacaaggatcacacccacaatgaaagagctccagatgatggttgaacatcacctggggcaacagcagcaaggagaggaacctgagggggccgctgagagcacaggaacccaggagtcccgcccacctgggatcccagacacagaagtggagtcaaggctgggcacctctgggacagcaaaaaaaactgcagaatgcatccctaaaactcacgaaagaggcagtaaggaacccagcacaaaagaaccctcaacccatataccaccactggattccaagggagccaactcggtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin domain containing 12 (endoplasmic reticulum)
- solute carrier family 31 (copper transporters), member 1
- MIS12, MIND kinetochore complex component, homolog (yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 8

Buy PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene now

Add to cart