Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene
PTXBC022470
New product
Data sheet of PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022470 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1R1A |
| Origin species: | Human |
| Product name: | PPP1R1A-protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene |
| Size: | 2ug |
| Accessions: | BC022470 |
| Gene id: | 5502 |
| Gene description: | protein phosphatase 1, regulatory (inhibitor) subunit 1A |
| Synonyms: | IPP1; protein phosphatase 1 regulatory subunit 1A; IPP-1; inhibitor-1; protein phosphatase inhibitor-1; protein phosphatase 1 regulatory inhibitor subunit 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcaagacaacagcccccaaaagatccagttcacggtcccgctgctggagccgcaccttgaccccgaggcggcggagcagattcggaggcgccgccccacccctgccaccctcgtgctgaccagtgaccagtcatccccagagatagatgaagaccggatccccaacccacatctcaagtccactttggcaatgtctccacggcaacggaagaagatgacaaggatcacacccacaatgaaagagctccagatgatggttgaacatcacctggggcaacagcagcaaggagaggaacctgagggggccgctgagagcacaggaacccaggagtcccgcccacctgggatcccagacacagaagtggagtcaaggctgggcacctctgggacagcaaaaaaaactgcagaatgcatccctaaaactcacgaaagaggcagtaaggaacccagcacaaaagaaccctcaacccatataccaccactggattccaagggagccaactcggtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thioredoxin domain containing 12 (endoplasmic reticulum) - solute carrier family 31 (copper transporters), member 1 - MIS12, MIND kinetochore complex component, homolog (yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 |