SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene View larger

SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene

PTXBC013611

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013611
Product type: DNA & cDNA
Ncbi symbol: SLC31A1
Origin species: Human
Product name: SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene
Size: 2ug
Accessions: BC013611
Gene id: 1317
Gene description: solute carrier family 31 (copper transporters), member 1
Synonyms: COPT1; CTR1; high affinity copper uptake protein 1; copper transport 1 homolog; copper transporter 1; solute carrier family 31 (copper transporter), member 1; solute carrier family 31 (copper transporters), member 1; solute carrier family 31 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcattcccaccatatggggatgagctatatggactccaacagtaccatgcaaccttctcaccatcacccaaccacttcagcctcacactcccatggtggaggagacagcagcatgatgatgatgcctatgaccttctactttggctttaagaatgtggaactactgttttccggtttggtgatcaatacagctggagaaatggctggagcttttgtggcagtgtttttactagcaatgttctatgaaggactcaagatagcccgagagagcctgctgcgtaagtcacaagtcagcattcgctacaattccatgcctgtcccaggaccaaatggaaccatccttatggagacacacaaaactgttgggcaacagatgctgagctttcctcacctcctgcaaacagtgctgcacatcatccaggtggtcataagctacttcctcatgctcatcttcatgacctacaacgggtacctctgcattgcagtagcagcaggggccggtacaggatacttcctcttcagctggaagaaggcagtggtagtggatatcacagagcattgccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MIS12, MIND kinetochore complex component, homolog (yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
- v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)
- polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa

Buy SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene now

Add to cart