Login to display prices
Login to display prices
SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene View larger

SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene

PTXBC013611

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene

Proteogenix catalog: PTXBC013611
Ncbi symbol: SLC31A1
Product name: SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene
Size: 2ug
Accessions: BC013611
Gene id: 1317
Gene description: solute carrier family 31 (copper transporters), member 1
Synonyms: COPT1; CTR1; high affinity copper uptake protein 1; copper transport 1 homolog; copper transporter 1; solute carrier family 31 (copper transporter), member 1; solute carrier family 31 (copper transporters), member 1; solute carrier family 31 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcattcccaccatatggggatgagctatatggactccaacagtaccatgcaaccttctcaccatcacccaaccacttcagcctcacactcccatggtggaggagacagcagcatgatgatgatgcctatgaccttctactttggctttaagaatgtggaactactgttttccggtttggtgatcaatacagctggagaaatggctggagcttttgtggcagtgtttttactagcaatgttctatgaaggactcaagatagcccgagagagcctgctgcgtaagtcacaagtcagcattcgctacaattccatgcctgtcccaggaccaaatggaaccatccttatggagacacacaaaactgttgggcaacagatgctgagctttcctcacctcctgcaaacagtgctgcacatcatccaggtggtcataagctacttcctcatgctcatcttcatgacctacaacgggtacctctgcattgcagtagcagcaggggccggtacaggatacttcctcttcagctggaagaaggcagtggtagtggatatcacagagcattgccattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: