TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene View larger

TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001493
Product type: DNA & cDNA
Ncbi symbol: TXNDC12
Origin species: Human
Product name: TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene
Size: 2ug
Accessions: BC001493
Gene id: 51060
Gene description: thioredoxin domain containing 12 (endoplasmic reticulum)
Synonyms: AG1; AGR1; ERP16; ERP18; ERP19; PDIA16; TLP19; hAG-1; hTLP19; thioredoxin domain-containing protein 12; ER protein 18; ER protein 19; anterior gradient homolog 1; endoplasmic reticulum protein ERp19; endoplasmic reticulum resident protein 18; endoplasmic reticulum resident protein 19; endoplasmic reticulum thioredoxin superfamily member, 18 kDa; protein disulfide isomerase family A, member 16; thioredoxin domain containing 12 (endoplasmic reticulum); thioredoxin-like protein p19; thioredoxin domain containing 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagacgcggcctcgtctcggggccacctgtttgctgggcttcagtttcctgctcctcgtcatctcttctgatggacataatgggcttggaaagggttttggagatcatattcattggaggacactggaagatgggaagaaagaagcagctgccagtggactgcccctgatggtgattattcataaatcctggtgtggagcttgcaaagctctaaagcccaaatttgcagaatctacggaaatttcagaactctcccataattttgttatggtaaatcttgaggatgaagaggaacccaaagatgaagatttcagccctgacgggggttatattccacgaatcctttttctggatcccagtggcaaggtgcatcctgaaatcatcaatgagaatggaaaccccagctacaagtatttttatgtcagtgccgagcaagttgttcaggggatgaaggaagctcaggaaaggctgacgggtgatgccttcagaaagaaacatcttgaagatgaattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 31 (copper transporters), member 1
- MIS12, MIND kinetochore complex component, homolog (yeast)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
- v-ets erythroblastosis virus E26 oncogene homolog 1 (avian)

Buy TXNDC12-thioredoxin domain containing 12 (endoplasmic reticulum) Gene now

Add to cart