LGALS3BP-lectin, galactoside-binding, soluble, 3 binding protein Gene View larger

LGALS3BP-lectin, galactoside-binding, soluble, 3 binding protein Gene


New product

Data sheet of LGALS3BP-lectin, galactoside-binding, soluble, 3 binding protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LGALS3BP-lectin, galactoside-binding, soluble, 3 binding protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002403
Product type: DNA & cDNA
Ncbi symbol: LGALS3BP
Origin species: Human
Product name: LGALS3BP-lectin, galactoside-binding, soluble, 3 binding protein Gene
Size: 2ug
Accessions: BC002403
Gene id: 3959
Gene description: lectin, galactoside-binding, soluble, 3 binding protein
Synonyms: 90K; BTBD17B; CyCAP; M2BP; MAC-2-BP; TANGO10B; gp90; galectin-3-binding protein; L3 antigen; MAC2BP; Mac-2-binding protein; basement membrane autoantigen p105; lectin galactoside-binding soluble 3-binding protein; mac-2 BP; serum protein 90K; transport and golgi organization 10 homolog B; tumor-associated antigen 90K; galectin 3 binding protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacccctccgaggctcttctgggtgtggctgctggttgcaggaacccaaggcgtgaacgatggtgacatgcggctggccgatgggggcgccaccaaccagggccgcgtggagatcttctacagaggccagtggggcactgtgtgtgacaacctgtgggacctgactgatgccagcgtcgtctgccgggccctgggcttcgagaacgccacccaggctctgggcagagctgccttcgggcaaggatcaggccccatcatgctggatgaggtccagtgcacgggaaccgaggcctcactggccgactgcaagtccctgggctggctgaagagcaactgcaggcacgagagagacgctggtgtggtctgcaccaatgaaaccaggagcacccacaccctggacctctccagggagctctcggaggcccttggccagatctttgacagccagcggggctgcgacctgtccatcagcgtgaatgtgcagggcgaggacgccctgggcttctgtggccacacggtcatcctgactgccaacctggaggcccaggccctgtggaaggagccgggcagcaatgtcaccatgagtgtggatgctgagtgtgtgcccatggtcagggaccttctcaggtacttctactcccgaaggattgacatcaccctgtcgtcagtcaagtgcttccacaagctggcctctgcctatggggccaggcagctgcagggctactgcgcaagcctctttgccatcctcctcccccaggacccctcgttccagatgcccctggacctgtatgcctatgcagtggccacaggggacgccctgctggagaagctctgcctacagttcctggcctggaacttcgaggccttgacgcaggccgaggcctggcccagtgtccccacagacctgctccaactgctgctgcccaggagcgacctggcggtgcccagcgagctggccctactgaaggccgtggacacctggagctggggggagcgtgcctcccatgaggaggtggagggcttggtggagaagatccgcttccccatgatgctccctgaggagctctttgagctgcagttcaacctgtccctgtactggagccacgaggccctgttccagaagaagactctgcaggccctggaattccacactgtgcccttccagttgctggcccggtacaaaggcctgaacctcaccgaggatacctacaagccccggatttacacctcgcccacctggagtgcctttgtgacagacagttcctggagtgcacggaagtcacaactggtctatcagtccagacgggggcctttggtcaaatattcttctgattacttccaagccccctctgactacagatactacccctaccagtccttccagactccacaacaccccagcttcctcttccaggacaagagggtgtcctggtccctggtctacctccccaccatccagagctgctggaactacggcttctcctgctcctcggacgagctccctgtcctgggcctcaccaagtctggcggctcagatcgcaccattgcctacgaaaacaaagccctgatgctctgcgaagggctcttcgtggcagacgtcaccgatttcgagggctggaaggctgcgattcccagtgccctggacaccaacagctcgaagagcacctcctccttcccctgcccggcagggcacttcaacggcttccgcacggtcatccgccccttctacctgaccaactcctcaggtgtggactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 2
- mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)
- solute carrier family 1 (glutamate transporter), member 7

Buy LGALS3BP-lectin, galactoside-binding, soluble, 3 binding protein Gene now

Add to cart