Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2I-polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa Gene
PTXBC017112
New product
Data sheet of POLR2I-polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2I-polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017112 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2I |
| Origin species: | Human |
| Product name: | POLR2I-polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa Gene |
| Size: | 2ug |
| Accessions: | BC017112 |
| Gene id: | 5438 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa |
| Synonyms: | RPB9; hRPB14.5; DNA-directed RNA polymerase II subunit RPB9; DNA-directed RNA polymerase II 14.5 kDa polypeptide; DNA-directed RNA polymerase II subunit I; RNA polymerase II 14.5 kDa subunit; RNA polymerase II subunit B9; RPB14.5; polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDa; polymerase (RNA) II subunit I; RNA polymerase II subunit I |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccgacgggacttacgagccgggcttcgtgggtattcgcttctgccaggaatgtaacaacatgctgtaccccaaggaagacaaggagaaccgcattctgctctacgcgtgccggaactgtgattaccagcaggaggccgacaacagctgcatctatgtcaacaagatcacgcacgaagtggacgaactgacccagattatcgccgacgtgtcccaggaccccacgttgccgcggaccgaggaccacccgtgccaaaagtgcggccacaaggaggctgtgttcttccagtcacacagtgcgcgggccgaggacgccatgcgcctttactacgtgtgcacagccccacactgcggccaccgctggaccgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) - signaling lymphocytic activation molecule family member 1 - RCD1 required for cell differentiation1 homolog (S. pombe) - lectin, galactoside-binding, soluble, 3 binding protein |