PSMD6-proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 Gene View larger

PSMD6-proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMD6-proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PSMD6-proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000630
Product type: DNA & cDNA
Ncbi symbol: PSMD6
Origin species: Human
Product name: PSMD6-proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 Gene
Size: 2ug
Accessions: BC000630
Gene id: 9861
Gene description: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: Rpn7; S10; SGA-113M; p42A; 26S proteasome non-ATPase regulatory subunit 6; breast cancer-associated protein SGA-113M; phosphonoformate immuno-associated protein 4; proteasome (prosome, macropain) 26S subunit, non-ATPase, 6; proteasome regulatory particle subunit p44S10; proteasome 26S subunit, non-ATPase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctggagaacctggaggaggagggtctgcccaagaaccccgacttgcgtatcgcgcagctgcgcttcctgctcagcctgcccgagcaccgcggagacgctgccgtgcgcgacgagctgatggcggccgtccgcgataacaacatggctccttactatgaagccttgtgcaaatccctcgactggcagatagacgtggacctactcaataaaatgaagaaggcaaatgaagatgagttgaagcgtttggatgaggagctggaagatgcagagaagaatctaggagagagcgaaattcgcgatgcaatgatggcaaaggccgagtacctctgccggataggtgacaaagagggagctctgacagcctttcgcaagacatatgacaaaactgtggccctgggtcaccgattggatattgtattctatctccttaggattggcttattttatatggataatgatctcatcacacgaaacacagaaaaggccaaaagcttaatagaagaaggaggagactgggacaggagaaaccgcctaaaagtgtatcagggtctttattgtgtggctattcgtgatttcaaacaggcagctgaactcttccttgacactgtttcaacatttacatcctatgaactcatggattataaaacatttgtgacttatactgtctatgtcagtatgattgccttagaaagaccagatctcagggaaaaggtcattaaaggagcagagattcttgaagtgttgcacagtcttccagcagttcggcagtatctgttttcactctatgaatgccgttactctgttttcttccaatcattagcggttgtggaacaggaaatgaaaaaggactggctttttgcccctcattatcgatactatgtaagagaaatgagaattcatgcatacagtcagctgctggaatcatataggtcattaacccttggctatatggcagaagcgtttggtgttggtgtggaattcattgatcaggaactgtccaggtttattgctgccgggagactacactgcaaaatagataaagtgaatgaaatagtagaaaccaacagacctgatagcaagaactggcagtaccaagaaactatcaagaaaggagatctgctactaaacagagttcaaaaactttccagagtaattaatatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sterile alpha motif and leucine zipper containing kinase AZK
- protein C (inactivator of coagulation factors Va and VIIIa)
- v-ets erythroblastosis virus E26 oncogene homolog 2 (avian)
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 3

Buy PSMD6-proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 Gene now

Add to cart