Login to display prices
Login to display prices
ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene View larger

ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene

PTXBC008861

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene

Proteogenix catalog: PTXBC008861
Ncbi symbol: ATP6V0D1
Product name: ATP6V0D1-ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Gene
Size: 2ug
Accessions: BC008861
Gene id: 9114
Gene description: ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Synonyms: ATP6D; ATP6DV; P39; VATX; VMA6; VPATPD; V-type proton ATPase subunit d 1; 32 kDa accessory protein; ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D; ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1; H(+)-transporting two-sector ATPase, subunit D; V-ATPase 40 KDa accessory protein; V-ATPase AC39 subunit; V-ATPase subunit d 1; V-ATPase, subunit D; vacuolar proton pump subunit d 1; ATPase H+ transporting V0 subunit d1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgttcttcccggagctttactttaacgtggacaatggctacttggagggactggtgcgcggcctgaaggccggggtgctcagccaggccgactacctcaacctggtgcagtgcgagacgctagaggacttgaaactgcatctgcagagcactgattatggtaacttcctggccaacgaggcatcacctctgacggtgtcagtcatcgatgaccggctcaaggagaagatggtggtggagttccgccacatgaggaaccatgcctatgagccactcgccagcttcctagacttcattacttacagttacatgatcgacaacgtgatcctgctcatcacaggcacgctgcaccagcgctccatcgctgagctcgtgcccaagtgccacccactaggcagcttcgagcagatggaggccgtgaacattgctcagacacctgctgagctctacaatgccattctggtggacacgcctcttgcggcttttttccaggactgcatttcagagcaggaccttgacgagatgaacatcgagatcatccgcaacaccctctacaaggcctacctggagtccttctacaagttctgcaccctactgggcgggactacggctgatgccatgtgccccatcctggagtttgaagcagaccgccgcgccttcatcatcaccatcaattctttcggcacagagctgtccaaagaggaccgtgccaagctctttccacactgtgggcggctctaccctgagggcctggcgcagctggctcgggctgacgactatgaacaggtcaagaacgtggccgattactacccggagtacaagctgctcttcgagggtgcaggtagcaaccctggagacaagacgctggaggaccgattctttgagcacgaggtaaagctgaacaagttggccttcctgaaccagttccactttggtgtcttctatgccttcgtgaagctcaaggagcaggagtgtcgcaacatcgtgtggatcgctgaatgtatcgcccagcgccaccgcgccaaaatcgacaactacatccctatcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: