Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene
PTXBC015517
New product
Data sheet of SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015517 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC26A1 |
| Origin species: | Human |
| Product name: | SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC015517 |
| Gene id: | 10861 |
| Gene description: | solute carrier family 26 (sulfate transporter), member 1 |
| Synonyms: | CAON; EDM4; SAT-1; SAT1; sulfate anion transporter 1; solute carrier family 26 (anion exchanger), member 1; solute carrier family 26 (sulfate transporter), member 1; sulfate anion tranporter AT1; sulfate/anion transporter SAT-1 protein; solute carrier family 26 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgagtcccctgagcctctgcagcagggcagagggccggtgccggtccgacggcagcgcccagcaccccggggtctgcgtgagatgctgaaggccaggctgtggtgcagctgctcgtgcagtgtgctgtgcgtccgggcgctggtgcaggacctgctccccgccacgcgctggctgcgtcagtaccgcccgcgggagtacctggcaggcgacgtcatgtctgggctggtcatcggcatcatcctggtgccgcaggccatcgcctactcattgctggccgggctgcagcccatctacagcctctatacgtccttcttcgccaacctcatctacttcctcatgggcacctcacggcatgtctccgtgggcatcttcagcctgctttgcctcatggtggggcaggtggtggaccgggagctccagctggccggctttgacccctcccaggacggcctgcagcccggagccaacagcagcaccctcaacggctcggctgccatgctggactgcgggcgtgactgctacgccatccgtgtcgccaccgccctcacgctgatgaccgggctttaccagacgtcctggggtagaaacagcttccagcaacacccatggcaattaacacagaggagtgactcgcaggaacttctggaagaggaggaaagatcttgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 - DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) - ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 - proteasome (prosome, macropain) 26S subunit, non-ATPase, 6 |