SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene View larger

SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015517
Product type: DNA & cDNA
Ncbi symbol: SLC26A1
Origin species: Human
Product name: SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene
Size: 2ug
Accessions: BC015517
Gene id: 10861
Gene description: solute carrier family 26 (sulfate transporter), member 1
Synonyms: CAON; EDM4; SAT-1; SAT1; sulfate anion transporter 1; solute carrier family 26 (anion exchanger), member 1; solute carrier family 26 (sulfate transporter), member 1; sulfate anion tranporter AT1; sulfate/anion transporter SAT-1 protein; solute carrier family 26 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgagtcccctgagcctctgcagcagggcagagggccggtgccggtccgacggcagcgcccagcaccccggggtctgcgtgagatgctgaaggccaggctgtggtgcagctgctcgtgcagtgtgctgtgcgtccgggcgctggtgcaggacctgctccccgccacgcgctggctgcgtcagtaccgcccgcgggagtacctggcaggcgacgtcatgtctgggctggtcatcggcatcatcctggtgccgcaggccatcgcctactcattgctggccgggctgcagcccatctacagcctctatacgtccttcttcgccaacctcatctacttcctcatgggcacctcacggcatgtctccgtgggcatcttcagcctgctttgcctcatggtggggcaggtggtggaccgggagctccagctggccggctttgacccctcccaggacggcctgcagcccggagccaacagcagcaccctcaacggctcggctgccatgctggactgcgggcgtgactgctacgccatccgtgtcgccaccgccctcacgctgatgaccgggctttaccagacgtcctggggtagaaacagcttccagcaacacccatggcaattaacacagaggagtgactcgcaggaacttctggaagaggaggaaagatcttgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
- DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
- ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
- proteasome (prosome, macropain) 26S subunit, non-ATPase, 6

Buy SLC26A1-solute carrier family 26 (sulfate transporter), member 1 Gene now

Add to cart